Грунтовка старатель: Грунтовки Старатели ⚒ в интернет–магазине – купить грунтовки в Москве

универсальное средство для покрытия стен, водный материал для внутренних работ в упаковках объемом 10 л, отзывы

Каждый профессионал знает, что основание необходимо подготовить перед любым типом отделки. Грунтование поверхности позволяет продлить срок эксплуатации декоративного покрытия и сэкономить расход отделочного материала. Грунтовка «Старатели» пользуется большим спросом, поскольку производитель предлагает только качественную продукцию по доступной цене.

Особенности

Российская компания «Старатели» производит качественные и конкурентоспособные материалы для строительства. В ассортименте бренда предложено несколько видов грунтовки. Их задача заключается в том, чтобы подготовить поверхность для дальнейшей работы.

Свойства грунтовки от компании «Старатели»:

  • позволяет быстро перейти к дальнейшей работе с основанием, поскольку характеризуется быстрым высыханием;
  • создаёт ровное и гладкое основание;
  • обеспечивает антисептическое действие, защищает основание от пара, влаги, появления плесени и впитывания жидкости;
  • способствует надёжному креплению к основанию отделочных материалов;
  • позволяет уменьшить расход лакокрасящих средств;
  • повышает надёжность нового покрытия;
  • улучшает прочность пористых поверхностей.

Технические характеристики

Компания «Старатели» предлагает несколько разновидностей грунтового раствора, но все виды имеют примерно одинаковые компоненты:

  • акриловый латекс высокого качества;
  • антисептическое вещество, которое нужно для устранения возможности образования грибка или плесени;
  • компоненты, которые предотвращают создание пены;
  • добавки, которые усиливают свойства проникновения раствора в поверхность.

Все разновидности грунтовок обладают кремообразной структурой, поэтому они быстро впитываются и позволяют придать поверхности прочность.

Они быстро высыхают после использования (большинство грунтовочных смесей высыхает за один час). После грунтования поверхность отлично пропускает воздух, поскольку на нём не образуется плёнка.

Многим пользователям нравится экономный расход грунтовочного раствора.

При работе с ровной поверхностью его можно развести с водой в пропорции 1: 1. Водный раствор позволит подготовить поверхность для дальнейших работ, а также сэкономить расход средства.

Разновидности

Компания «Старатели» предлагает пять видов грунтовки, что позволяет подобрать оптимальный вариант под определённые цели.

Для внутренних работ

Этот вариант предназначен для осуществления работ в помещениях. Его можно применять для обработки пола, стен и потолка. Он предназначен для таких оснований, которые из-за высокой плотности плохо впитывают влагу. Идеально подходит для грунтования гипсокартона, пеногазобетона и бетонных поверхностей.

Время высыхания средства составляет всего до одного часа. Грунтовочная смесь отличается небольшим расходом, поскольку на 1 м² уходит всего от 100 до 200 мл раствора. Выпускается в ёмкостях 5 и 10 л.

После использования этого средства поверхность является готовой к шпатлеванию, окраске, облицовке керамической плиткой, оклейке обоями. На основание можно стелить линолеум, ковровое покрытие или штучный паркет, а также производить штукатурные работы.

Универсальная

Этот вид подходит для выполнения грунтования оснований в помещениях и под открытым небом. Его можно использовать даже при повышенной влажности. Он отлично подходит для работы с бетонными блоками, гипсокартоном, пеногазобетоном, а также непрочными поверхностями.

Универсальная грунтовка обеспечивает улучшенную адгезию наносимых материалов к бетонному, кирпичному или оштукатуренному основанию. Она позволяет уменьшить расход лакокрасящих средств, а также придаёт поверхности дополнительную прочность.

Уже через час после грунтования поверхность является готовой для дальнейших работ: окрашивания, поклейки обоев, шпатлевания, укладки плитки или оштукатуривания. Универсальная грунтовка позволяет подготовить основание перед укладкой различных напольных покрытий. Она выпускается в трёх вариантах фасовки: в канистрах на 1.5 и 10 л. Расход раствора на 1 м² составляет от 100 до 200 мл.

Глубокого проникновения

Этот вид идеально подходит для внешних и внутренних работ. Грунтовка глубоко проникает в основание, способствует усилению адгезии, а также придаёт поверхностям прочности. Её можно наносить на непрочные и плохо впитывающие основания, такие как бетон, гипсокартон или пеногазобетон.

Высыхание поверхности осуществляется за один час. Расход средства составляет всего от 100 до 200 мл на 1 м².

Производитель рекомендует наносить грунт на основание, применяя валик, кисточку или краскопульт, при этом температура воздуха должна быть от 5 до 30 градусов тепла.

Средство продаётся в канистрах 5 и 10 л.

Для пористых и сильно впитывающих оснований

Эту грунтовку можно применять для работы не только в помещениях, но и на улице. Она подходит даже для использования в помещениях с повышенной влажностью. Её можно наносить на ячеистый бетон, к примеру, на газобетон или пенобетон.

Время высыхания варьируется от 4 до 6 часов. Грунтовка наносится на основание перед штукатурными работами. Расход средства на 1 м² составляет 300-400 граммов. Грунтовку можно приобрести в фасовке 6 и 15 кг.

Бетон-контакт

Эта разновидность разработана специально для улучшения адгезии при работе с гладкими бетонными основаниями. Она может применяться и для предварительной обработки плотных поверхностей. Подходит исключительно для работ внутри помещений.

С помощью бетон-контакта можно прогрунтовать плотные, плохо впитывающие влагу основания, гипсокартон и старое керамическое покрытие.

Грунтование основания стоит проводить перед штукатурными работами и укладкой плитки.

Грунтовка отличается повышенной вязкостью. Она великолепно заполняет все поры основания. Производитель подчёркивает необходимость устранения пыли с основания перед нанесением грунтовки. Расход средства на 1 м² составляет 300-400 граммов. Фасовка бетон-контакта представлена весом 3, 5 и 20 кг.

Как правильно использовать?

Каждый вид грунтовочного раствора от бренда «Старатели» является готовым к использованию, что экономит время и силы.

При работе с материалом следует придерживаться определенного алгоритма.

  • Сначала нужно произвести работы по подготовке основания. С поверхности следует устранить пыль, грязь, остатки предыдущих материалов. Перед грунтованием основание должно быть не только чистым, но и сухим.
  • Для защиты окон и дверей от попадания средства, необходимо воспользоваться прозрачной плёнкой. Потом капельки грунта будет устранить очень тяжело.
  • После высыхания основания можно начинать грунтование.
  • Грунтовку рекомендуется налить в тару малого размера для удобства выполнения работ.
  • С помощью кисточки или валика с большим ворсом можно начинать работу. Чтобы ускорить процесс, используется пульверизатор.
  • Работы с грунтовкой следует осуществлять при температуре воздуха не ниже пяти градусов тепла.

Отзывы

Российская компания «Старатели» предлагает богатый выбор строительных материалов, но большим спросом пользуется именно грунтовка. Положительные отзывы о продукте оставляют не только новички в строительной сфере, но и настоящие профессионалы.

Пользователи продукции компании «Старатели» указывают на ее отменное качество. Грунтовочный материал характеризуется универсальностью, прочностью и практичностью. Он обеспечивает отменную адгезию, поскольку после грунтования покрытие лучше сцепляется с различными облицовочными материалами.

Грунтовка от бренда «Старатели» обладает великолепными антисептическими свойствами. На обработанном основании, даже спустя несколько лет, не проявляется плесень или грибок. Грунт характеризуется отсутствием запаха и является полностью безопасным для организма человека. Многих покупателей привлекает ещё и доступная стоимость продукции.

О том, как правильно грунтовать стены, вы узнаете из следующего видео.

Грунтовка Старатели Бетон-контакт: характеристика и использование

Бетон контакт – вспомогательный состав, используется в строительном производстве. Во время ремонта часто возникают ситуации, когда штукатурка не держится на стенах. В таких случаях без грунтовки не обойтись. На помощь приходит бетон контакт Старатели, обеспечивающий прочную основу для нанесения штукатурки.

Область применения

Грунтовками пользуются для внутренних и внешних обработок площадей в помещениях с любой влажностью. В структуру грунтовки входят особенные наполнители, позволяющие использовать сцепляющую смесь для обработки бетонированных площадей плотных оснований, улучшения прилипания штукатурки, плитки.

Грунтовка отлично ложится на ровные поверхности. Даже если бетон контакт ложится на наслоение краски, основание приобретает шероховатость. Ощущение шероховатости раствору придает адгезионные составляющие, входящие в состав.

Безупречному сцеплению с грунтовкой поддается исключительно верхний слой, поэтому смесь лучше наносить на крепкие, прочные слои. Бетон контактом не смазывают площади покрытые керамической плитки, масляной краской, железными листами. Грунтовый состав годен к применению во всех зданиях, даже с предположительными постоянными влажными дезинфицирующими уборками.  Исключением является употребление раствора для поверхностей, находящихся в контакте с пищей и питьевой водой. В таких комнатах бетон контакт не подходит для применения.

Вернуться к оглавлению

Техническая характеристика

Данным материалом работы проводятся при температуре от +5 и до +25.

Строительный рынок предоставляет широкий выбор смеси бетона контакта. Самая популярная фирма, производящая вспомогательную смесь, Старатели. Смесь компонентов, используемых при приготовлении, позволяет материалу обладать влагостойкостью, антисептическим действием, иметь высокую пропускаемость газов, износостойкость, пожаробезопасность. Материал расходуется не расточительно, на квадратный метр уходит 0,3 кг, допускается сокращение расхода, качество не пострадает.

Вернуться к оглавлению

Преимущества грунтования

Применяя в роботе смесь Старатели, вы оцените достоинства:

  • надежная сцепляемость строительных материалов с рабочей поверхностью;
  • состав быстро сохнет, что разрешает приступить к следующим работам через 2 часа;
  • экономный расход;
  • предварительной подготовки раствора не нужно, он целиком готов к эксплуатации.
Вернуться к оглавлению

Подготовительные работы

Перед нанесением смеси стоит осмотреть, тщательно подготовить поверхность для дальнейшей работы. Основание должно быть прочным, очищенным от шелушения второстепенных слоев, загрязнений пыли, жировых пятен, обязательно сухим. Качественное очищение обеспечит легкое нанесение, проникновение грунтовки в основание и длительное использование.

Вернуться к оглавлению

Выполнение работы

Бетон-контакт в работе.

Перед нанесением грунтовку стоит размешать. Качественно покрыть поверхности раствором поможет кисточка с поперечным размером 10 см или покрасочный валик длинной 25 см. Работы по нанесению грунтовой смеси отлично выполняются краскопультом.

Температура воздуха при выполнении операции соответствует не ниже 5, не выше 25 градусов. Валик, кисточка полностью смачивается раствором и наносят его на рабочую площадь. Следите за качеством нанесения, не допускайте образования пропусков. Допускается нанесение грунтовки в несколько слоев, но перед нанесением следующего слоя обязательно проверяется на сухость прежний. Все инструменты после окончания работы тщательно промываются водой. Работать стоит в специальных защитных перчатках.

Бетон контакт, попавший на кожу, промывают водой, в глаза – промыв достаточным количеством воды, обратитесь за помощью к врачу.

Вернуться к оглавлению

Упаковка

Грунтовка выпускается в пластиковых ведрах. Масса ведра 3, 6, 20, 50 кг.

Вернуться к оглавлению

Хранение

Грунт хранится в герметичных упаковках, при температуре не ниже 5, не выше 30 градусов тепла. Раствор прекрасно выдерживает пять циклов заморозки и разморозки, не теряя особенных свойств. При правильном хранении бетон контакт не теряет индивидуальные свойства, пригоден к использованию 12 месяцев после изготовления.

Вышеописанный бетон – отличный выбор для гладких стен с низким уровнем адгезии. Высокий уровень сцепления, возможность нанесения штукатурки, декоративных смесей – отличный результат. Его по достоинству оценят профессиональные строители, и мастера-любители.

грунтовка Старатель 10л — Штрих-код: 4601745000575

Результаты поиска Штрих-код: 4601745000575

Наши пользователи определили следующие наименования для данного штрих-кода:

Штрих-код Наименование Единица измерения Рейтинг*
1 4601745000575 ГРУНТОВКА СТАРАТЕЛЬ 10Л ШТ. 13
2 4601745000575 ГРУНТОВКА ДЛЯ ВНУТРЕННИХ РАБОТ 10Л СТАРАТЕЛИ ШТ. 2
3 4601745000575 ГРУНТОВКА 10Л СТАРАТЕЛЬ ДЛЯ ВНУТР.РАБОТ ШТ. 1
4 4601745000575 ГРУНТ СТАРАТЕЛИ ДЛЯ ВНУТРЕННИХ РАБОТ 10 Л ШТ 1
5 4601745000575 ГРУНТОВКА ДЛЯ ВНУТРЕННИХ РАБОТ СТАРАТЕЛИ 10Л ШТ. 1
6 4601745000575 ГРУНТ ДЛЯ ВН РАБ 10 Л СТАРАТЕЛИ ШТ. 1
7 4601745000575 ГРУНТОВКА ДЛЯ ВНУТРЕННИХ РАБОТ СТАРАТЕЛИ 10 Л КГ 1

* Рейтинг — количество пользователей, которые выбрали это наименование, как наиболее подходящее для данного штрих-кода

Поиск: грунтовка Старатель

Старатель

Название:

Выберите категорию:Все СУХИЕ СТРОИТЕЛЬНЫЕ СМЕСИ» ЦЕМЕНТ И ПЕСКОБЕТОН»» ЦЕМЕНТЫ»» РУСЕАН»» ЮНИС»» ЭТАЛОН»» ЭКСПРЕСС+»» PROFESSIONAL»» EUROmix»» ТИТАН»» КАМЕННЫЙ ЦВЕТОК»» CERESIT»» DAUER»» ГЕРМЕС»» АНКЕР» ШПАТЛЕВКА, ШТУКАТУРКА»» РУСЕАН»» ВОЛМА»» UNIS»» KNAUF»» ВЕБЕР-ВЕТОНИТ»» ЭТАЛОН»» СТАРАТЕЛИ»» ОСНОВИТ»» GLIMS» ПЛИТОЧНЫЕ КЛЕИ»» ВОЛМА»» КНАУФ»» РУСЕАН»» UNIS»» СТАРАТЕЛИ»» ВЕТОНИТ»» CERESIT»» ЭТАЛОН»» GLIMS»» ЛИТОКОЛ»» DAUER»» ОСНОВИТ»» ФЛАГМАН»» PLITONIT»» PRO» НАЛИВНЫЕ ПОЛЫ И СТЯЖКА»» ВЕБЕР-ВЕТОНИТ»» KNAUF»» UNIS»» ВОЛМА»» РУСЕАН»» СТАРАТЕЛИ»» ОСНОВИТ»» GLIMS»» CERESIT»» DAUER»» КЕРАМЗИТ, ЗАСЫПКИ» ГОТОВЫЕ СМЕСИ ГИПСОКАРТОНЫ» КНАУФ» ВОЛМА» МАГМА» ГИПСОВОЛОКНО ПРОФИЛИ, НАПРАВЛЯЮЩИЕ, УГОЛКИ, КРЕПЕЖИ И МАЯКИ» Профиль KNAUF» Профиль Италия» Профиль СТиВ 0,40 мм» Профиль 0,55мм» Уголки, крепежи и маяки»» Кнауф»» Обычные ПЕНОБЛОКИ, КИРПИЧИ И ПАЗОГРЕБНЕВЫЕ ПЛИТЫ» ПАЗОГРЕБНЕВЫЕ ГИПСОВЫЕ ПЛИТЫ»» ПГП Волма»» ПГП Кнауф»» ПГП Русеан» ПЕНОБЛОКИ» КЕРАМЗИТНЫЕ, БЕТОННЫЕ БЛОКИ» КИРПИЧ СТРОИТЕЛЬНЫЙ» КИРПИЧ ОБЛИЦОВОЧНЫЙ» КИРПИЧ ПЕЧНОЙ И ОГНЕУПОРНЫЙ УТЕПЛИТЕЛИ, ТЕПЛОИЗОЛЯЦИИ» ЭКСТРУДИРОВАННЫЙ ПЕНОПОЛИСТИРОЛ»» URSA XPS»» ПЕНОПЛЭКС»» ТЕХНОПЛЕКС»» ПЕНОПЛАСТ» KNAUF» URSA» IZOVOL» IZOBEL» ТЕХНОНИКОЛЬ» ROCKWOOL» ISOROC» ОТРАЖАЮЩАЯ ТЕПЛОИЗОЛЯЦИЯ ГИДРОИЗОЛЯЦИОННЫЕ МАТЕРИАЛЫ» РУЛОННЫЕ ГИДРОИЗОЛЯЦИИ»» ТЕХНОНИКОЛЬ»» ШУМАНЕТ»» ИЗОАРТ» МЕМБРАНЫ»» ЮТАФОЛ»» ТАЙВЕК»» ИЗОВЕК»» ФОЛДЕР»» ИЗОСПАН»» РОКВУЛ»» ТЕХНОСПАН»» ИЗОЛАР»» ИЗОНИТ» ГИДРОИЗОЛЯЦИЯ И ОГНЕБИОЗАЩИТА» МАСТИКА, ПРАЙМЕРЫ БЕТОНОКОНТАКТ, ГРУНТОВКА, КЛЕИ» БЕТОНОКОНТАКТ»» КНАУФ»» РУСЕАН»» ГЕРМЕС»» СТАРАТЕЛИ»» МАСТЕР КЛАСС»» CERESIT» ГРУНТОВКА»» КНАУФ»» ГЕРМЕС»» РУСЕАН»» UNIS»» СТАРАТЕЛИ»» CERESIT»» МАСТЕР КЛАСС» ЖИДКИЕ КЛЕИ»» ГЕРМЕС»» МАСТЕР КЛАСС»» BOSTIK» ОБОЙНЫЕ КЛЕИ»» ОСКАР»» ГЕРМЕС»» МАСТЕР КЛАСС» РАСТВОРИТЕЛИ ПЕНА, ГЕРМЕТИКИ И ЖИДКИЕ ГВОЗДИ» ГЕРМЕТИКИ» ПЕНА МОНТАЖНАЯ» ЖИДКИЕ ГВОЗДИ МОНТАЖНЫЕ, МОЛЯРНЫЕ ИНСТРУМЕНТЫ И СОПУТСТВУЮЩИЕ ТОВАРЫ» КРЕСТИКИ ДЛЯ ПЛИТКИ» МОНТАЖНЫЙ ИНСТРУМЕНТ»» Пистолет для пены, герметиков»» Степлеры и скобы»» Ножи технические»» Ножницы по металлу» МАЛЯРНЫЙ И ШТУКАТУРНЫЙ ИНСТРУМЕНТ»» Аксессуары штукатурные и малярные»» Валики и ролики малярные»» Ванночка (Кювета) малярная пластмассовая»» Гладилки штукатурные»» Кисти, макловицы»» Мастерки, кельмы»» Миксеры строительные»» Отвесы, разметочные нити»» Уровень алюминиевый»» Терки штукатурные»» Шпатели» ХОЗЯЙСТВЕННЫЕ ТОВАРЫ»» Стремянки»» Рулетки»» Перчатки, рукавицы»» Уборочный инвентарь»» Ящик для инструмента» ПЛЕНКИ, СЕТКИ, ЛЕНТЫ И СКОТЧИ»» Пленки»» Скотч»» Сетка, стеклохолст»» Ленты бумажные»» Лента уплотнительная» БУРЫ, ПИКИ, ЛОПАТЫ И СВЕРЛА»» Бур по бетону ПИЛОМАТЕРИАЛЫ» Евровагонка»» Класс А»» Класс В»» Класс С»» Класс Экстра»» Класс АВ» Вагонка Штиль» Вагонка клееная» Брус клееная» Блок Хаус» Имитация бруса» Европол» Брус сухой строганный» Брус обрезной» Доска террасная» Доска строганная» Доска обрезная ФАНЕРА, ОСБ, ДВП и ДСП» ФАНЕРА»» ФАНЕРА ФК»»» ФАНЕРА КАЛИБРОВАННАЯ»»» ФАНЕРА ШЛИФОВАННАЯ БЕРЕЗА»»» ФАНЕРА НЕШЛИФОВАННАЯ БЕРЕЗА»» ФАНЕРА ВОДОСТОЙКАЯ ФСФ ХВОЯ»» ФАНЕРА ЛАМИНИРОВАННАЯ» ПЛИТЫ OSB» ДВП ОРГАЛИТ» ПЛИТЫ ЛДСП» ПЛИТЫ ДСП МЕТАЛЛОПРОКАТ» Сетка металлическая»» Сетка рабица»» Сетка сварная дорожная (в картах)»» Сетка сварная кладочная (в рулонах)»» Сетка сварная ПВХ»» Сетка штукатурная» Арматура»» Арматура А500С»» Арматура А1 Катанка»» Арматура композитная» Листовой прокат»» Лист оцинкованный»» Лист стальной» Балка двутавровая» Квадрат стальной» Полоса» Проволока вязальная» Труба профильная» Труба водогазопроводная» Трубы оцинкованные» Труба электросварная» Уголок стальной» Швеллер КРЕПЕЖИ СТРОИТЕЛЬНЫЙ» АНКЕРЫ»» Анкер болты»» Анкер забивной»» Анкер клин» ДЮБЕЛИ, ДЮБЕЛЬ-ГВОЗДИ»» Дюбеля»» Дюбель-гвоздь»» Дюбель-гриб для теплоизоляции» САМОРЕЗЫ, ШУРУПЫ»» Саморезы для ГКЛ в металл»» Саморезы для ГКЛ по дереву»» Саморезы для ГВЛ»» Саморезы кровельные»» Саморезы оконные»» Саморезы с прессшайбой»» Саморез клопы»» Шурупы» БОЛТЫ, ГАЙКИ, ШАЙБЫ И ШПИЛЬКИ»» Болты»» Гайки»» Шайбы»» Шпильки АЦЭИД И ЦСП ПЛИТЫ ЖЕЛЕЗОБЕТОННЫЕ ИЗДЕЛИЯ» КОЛЬЦА КОЛОДЕЗНЫЕ» КОЛЬЦА КОЛОДЕЗНЫЕ С ДНИЩЕМ» ДНИЩА КОЛОДЦЕВ» ЛЮК КАНАЛИЗАЦИОННЫЙ» ДОБОРНЫЕ КОЛЬЦА ДЛЯ КОЛОДЦЕВ» КРЫШКА ДЛЯ КОЛОДЦЕВ» ТРУБЫ АСБЕСТОЦЕМЕНТНЫЕ КРОВЕЛЬНЫЕ МАТЕРИАЛЫ» ПРОФНАСТИЛ»» Профнастил крашеный»» Профнастил оцинкованный» ОНДУЛИН

Производитель:Все4wallsAlpinaAxtonBeckersBikoBONOLITBostikBritzCaparolCeresitCoverCoverCrownDanogipsDauerDexxDufaDuluxEurocementEUROmixFAP CeramicheFassaden luxFeidalFenixFinncolorFlag-manFlatFlüggerFolder/ПольшаGirpaintGlimsHammeriteHaweraHolcimHorhofIekIrfixIsoboxIsorocIsover classicIzovolJetfixKleoKnaufKraftoolKreidezeitKronospanLegrand ValenaLitokolMakroflexMapeiMarshallMasterMatrixMaxiNeomidNorgipsOSBOscarOsсarPinotexPlitonitPrimaProProfessionalProfiProMasterPufasPyramid-apRespectRockwoolSalamanderSDS plusSementol KaowaSheetrockSibirSPASplineStandardStarlineStayerTeknosTikkurilaTitanTitebondTitebondTorxTyvekUltralamUnisUniversalUrsaVerputzVertexVGTVincentWDSWelltonX-glassА1А500САББАзия ЦементАнкерАнкер болтыАнкер клинАнкерные болты с гайкойАнкерные болты с крюкомАнкерный болт с кольцомАнкерный болт с костылемАнкеры забиваемыеАРЕАЛ+АрматураАрматура катанкаАтакаАЦЭИДБалка ДвутавроваяБитумБлок — хаусБолтыБрус обрезнойБрус строганныйБуры по бетонуВалик аэрационныйВаликиВанночки малярныеВебер-ВетонитВолмаВыключателиГайкиГайки самоконтрящиесяГерманияГермесГипрокГлавный ТехнологГладилкиГлобалГребенкиДВПДиски алмазныеДиски отрезныеДиски пильныеДоска обрезнаяДоска строганнаяДСПДюбели для теплоизоляцииДюбели по бетону и кирпичуДюбель гвоздиЕврополЖесткие профиляЗаклепочникиЗубрИзоартИзобелИзовекИзоларИзонитИзослойИзоспанИмитация брусаИнтекИнтерсколИталияКалевалаКалибрКаменный цветокКБСКельмыКерамзитКерамзитные блокиКирпич облицовочныйКирпич огенупорныйКирпич рабочийКисти простыеКисти узкие и радиаторныеКисти флейцевыеКисти экономКитайКласс АКласс ВКласс СКласс ЭкстраКольца доборныеКольца колодезныеКомандорКомпозитКонкордКоронки по бетонуКреостЛАМИНИРОВАННАЯЛАМИНИРОВАННАЯ КИТАЙЛенты бумажныеЛенты для шлифмашинЛипаЛист оцинкованныйЛиственницаЛЮКСТЕЙПМагмаМагмаМакловицыМастер БетонМастер КлассМДФМеталл-металл клопыМиксерыМКУМоментМонолитМосстройМосфолНовбытхимОптимаОптцементторгОрионОсинаОсновитОтделЦентрСтройОттомПеноблокиПеноплэксПеремычкиПирамидПистолетыПЛЕНКИПодоконникиПолимаксПОЛИСПЕНПолосы стальныеПортландцементПравила АлюминиеваяПроволока ВязальнаяПроизводитель №1Производитель №2Профиль ГерманияПрофнастилРазеткиРесантаРоссияРукав газовыйРусеанСадово-строительный инвентарьСаморез гипсокартон-деревоСаморез гипсокартон-металлСаморез для гипсоволокнаСаморез по дереву жолтыйСаморез прессшайба острыйСаморез прессшайба сверлоСаморезы для гипсокартона белый цинкСаморезы кровельныеСаморезы оконныеСантехнический крепежСВЕЗА-ЛесСверла по деревуСверла по металлуСверло по кафелю и стеклуСевкабельСетка арматурнаяСетка бухтаСетка кладочнаяСетка оцинкованнаяСетка плетёнкаСетка просечкаСетка фасаднаяСкобыСкотчСнежинкаСоснаСпецЭлектродСтарателиСтеплерыСТиВСтробиСтроительные емкостиТексТеркиТехноникольТехноплексТехноспанТЗИТитанТитан ПлюсТМ СибртехТруба ВодогазопроводнаяТруба оцинкованнаяТруба электросварнаяТрубы квадратныеУголки стальныеУдлинители и бюгелиФинляндияХвояЦСПШайбы гроверныеШайбы плоскиеШайбы плоские увеличенныеШвейцарияШвеллераШкурка ШлифовальнаяШлицШпателяШпилька резьбоваяШуманетШуруп и крюкиЭКОЭконом профиляЭкспертЭкспресс+ЭмпилсЭталонЮтафол

Новинка: Всенетда

Спецпредложение: Всенетда

Результатов на странице: 1224364860728496108120

Найти

Primer Prospector Обзорное руководство — Домашняя страница

В этом руководстве объясняется, как использовать конвейер Primer Prospector для создания праймеров de novo и анализа этих праймеров de novo , а также известных праймеров для прогнозирования таксономического охвата.

Образцы файлов находятся в каталоге pprospector / doc / tutorial_files /. Этот каталог содержит две папки, одна из которых содержит файлы образцов, de_novo_files /, для конвейера de novo , а вторая папка, analysis_files /, содержит файлы образцов для использования конвейера анализа Primer Prospector.

Последовательности, используемые в этом руководстве, были предоставлены Greengenes. Файл таксономического присвоения, а также полный эталонный набор последовательностей 97% OTU Greengenes доступны в виде zip-файла.

В этом руководстве подробно рассматриваются формат входных файлов и основные выходные данные Primer Prospector. Дополнительные сведения о формате файлов, создаваемых и используемых Primer Prospector, см. В документации.

De Novo Трубопровод грунтовки
Generating
De Novo Праймеры

Самая простая генерация праймеров de novo требует выровненного набора последовательностей fasta.Здесь можно загрузить небольшой набор образцов из 18 выровненных бактериальных последовательностей (щелкните правой кнопкой мыши и выберите «Сохранить как» или «Загрузить»).

Для создания праймеров de novo из этих выровненных последовательностей используется сценарий generate_primers_denovo.py. Этот модуль находит консервативные короткие последовательности во входном выровненном файле fasta для использования в качестве 3 ’области праймера. По умолчанию, консервативные наборы из пяти пар оснований обнаруживаются и записываются вместе с последовательностями, идущими вверх и вниз от этих консервативных сайтов.Чтобы запустить этот модуль с настройками по умолчанию, перейдите в каталог, в котором в настоящее время находятся образцы последовательностей, и используйте следующую команду:

 generate_primers_denovo.py -i sample_bacteria_seqs_aligned.fasta -o default_settings_primers.txt 

Выходной файл default_settings_primers.txt должен содержать такие строки:

 # Совпадения, которые обнаруживаются как минимум в 60,00% целевых последовательностей
# тип записи, последовательность, невыровненный индекс, выровненный индекс, количество идеальных совпадений, процент идеальных совпадений, процент неспецифических совпадений
C, GTAAA, 402,2039,18,100.0%, 0,0%
M, 2039, GACGGCCTTCGGGTTGTAAA, GTAAACCTCTTTCAGCAGGG, 11544
M, 2039, GACGCATTTCGGTGTGTAAA, GTAAACTCCTTTTATATGTC, 57484
M, 2039, GAAGGCCCTCGGGTTGTAAA, GTAAAGCACTTTCAGTAGGG, 103547
M, 2039, GAAGTATTTCGGTATGTAAA, GTAAAGCTCTATCAGCAGGG, 120123
 

Здесь показаны сохраняемый сайт, GTAAA, место, где он был первоначально найден (402, 2039), а также количество и процент найденных последовательностей с идеальным совпадением (18, 100%). Как можно видеть здесь, восходящие и нисходящие последовательности не обязательно сохраняются.Default_settings_primers.txt возвращает большое количество сохраненных сайтов из-за мягких настроек по умолчанию. Можно повысить требования к чувствительности для этих перспективных праймеров de novo , установив более высокий порог с помощью параметра -p. Кроме того, местоположение исходного праймера может быть не очень информативным для истинного местоположения праймера, поэтому может быть предоставлена ​​эталонная последовательность, чтобы дать более разумный индекс для праймеров de novo .Например, можно назвать новые рибосомные праймеры с малой субъединицей на основе последовательности E. coli , на которой основано большинство таких праймеров. Пример последовательности E. coli , полученный от Greengenes, можно загрузить здесь (щелкните правой кнопкой мыши и выберите «Сохранить как» или «Загрузить»).

Чтобы увеличить порог чувствительности для консервативных сайтов и присвоить праймерам стандартный индекс, основанный на последовательности E. coli , используйте следующую команду:

 generate_primers_denovo.py -i sample_bacteria_seqs_aligned.fasta -p 0.95 -a ecoli_sequence.fasta -o std_index_95_perc_sensitivity.txt 

Выходной файл std_index_95_perc_sensitivity.txt будет намного меньше из-за более жесткого 95% порога чувствительности и будет содержать дополнительные индексы, основанные на индексе, найденном в последовательности E. coli . Некоторые примеры строк приведены ниже:

 # Совпадения, которые обнаруживаются как минимум в 95,00% целевых последовательностей
# тип записи, последовательность, невыровненный индекс, выровненный индекс, количество точных совпадений, процент идеальных совпадений, процент неспецифических совпадений, стандартный индекс прямого праймера, стандартный индекс обратного праймера
C, TGCCA, 465, 2228, 18, 100.0%, 0,0%, 502 537
M, 2228, CACCGGCCAACTACGTGCCA, TGCCAGCAGCCGCGGTAATA, 11544
M, 2228, CACCGGCTAACTCCGTGCCA, TGCCAGCAGCCGCGGTAATA, 57484
M, 2228, CACTGGCTAACTCTGTGCCA, TGCCAGCAGCCGCGGTAATA, 103547
 

Дополнительные прямые и обратные стандартные индексы основаны на индексе предполагаемого праймера, который был обнаружен в последовательности E. coli , с поправкой на длину записанных последовательностей (в данном случае 20 пар оснований). Все индексы праймеров в Primer Prospector по возможности названы в честь 5’-пары оснований праймера.К сожалению, этот стандарт не согласуется с праймерами из литературы, поэтому помните об этом при смешивании и сопоставлении праймеров из разных источников.

Другие особенности generate_primers_denovo.py включают поиск консервативных сайтов, специфичных для группы последовательностей, и ограничение генерации праймеров конкретным сегментом выровненных последовательностей-мишеней fasta. Чтобы найти последовательности, которые являются специфичными, необходимо предоставить файл fasta с последовательностями, которые необходимо исключить (т.е. эти последовательности не имеют таких же консервативных сайтов, что и целевые последовательности).Например, можно найти праймеры, нацеленные на бактериальные, но не на архейные последовательности. Здесь можно загрузить образец выровненного файла fasta с двумя последовательностями архей (щелкните правой кнопкой мыши и выберите «Сохранить как» или «Загрузить»), который передается в generate_primers_denovo.py с параметром -e. Чтобы выбрать ограниченный диапазон выравнивания для поиска, параметр -r используется с X: Y, где X — это начальный индекс для поиска, а Y — конечный индекс. Ниже приведен пример команды, в которой используются все параметры, которые обсуждались до сих пор:

 generate_primers_denovo.py -i sample_bacteria_seqs_aligned.fasta -p 0.95 -a ecoli_sequence.fasta -o final_denovo_primers.txt -e sample_archaeal_seqs_aligned.fasta -r 1000: 3000 

Файл final_denovo_primers.txt, созданный с этими параметрами, немного меньше и более детализирован, чем начальные праймеры, и будет использоваться на следующем этапе конвейера de novo .

Сортировка и фильтрация
De Novo Праймеры

sort_denovo_primers.py используется для объединения, сортировки и сравнения полных последовательностей праймеров, созданных с помощью generate_primers_denovo.ру. Файл final_denovo_primers.txt, созданный на предыдущем шаге, можно использовать в этом руководстве или загрузить здесь (щелкните правой кнопкой мыши и выберите «Сохранить как» или «Загрузить»).

Ниже приводится основная команда sort_denovo_primers.py, которая использует настройки по умолчанию:

 sort_denovo_primers.py -i final_denovo_primers.txt 

При запуске этого сценария будут выведены два файла: formatted_primers.txt и primers_details.txt. Для получения дополнительной информации о формате и данных в primers_details.txt см. документацию. Праймеры de novo сохраняются в формате, пригодном для последующего анализа, в файле formatted_primers.txt. Фрагмент этого файла показан ниже:

 # primer_id  последовательность праймера (5 '-> 3')
347f GGGAGGCAGCAGTGRGGAAT
387f CTGAYSCAGCRAYGCCGCGT
<снип>
366r TTCCYCACTGCTGCCTCCCG
542r CTMCGTATTACCGCGGCTGC
360r ACTGCTGCCTCCCGTAGGAG
 

Обратите внимание, что сначала перечислены прямые праймеры, а затем обратные праймеры.По умолчанию эти праймеры отсортированы по убыванию чувствительности (поскольку все эти de novo праймеров имели 100% совпадение с целевыми последовательностями, порядок является случайным). И прямой, и обратный праймеры перечислены в направлении от 5 ’к 3’, и все модули в Primer Prospector, которые принимают вводимые праймеры, используют этот формат.

На этом этапе возможно сравнение с известными праймерами, чтобы избежать случайного повторного использования уже существующих праймеров. Правильно отформатированный файл праймеров, содержащий несколько известных праймеров (27f, 338r, 515f, 806r), можно загрузить здесь (щелкните правой кнопкой мыши и выберите «Сохранить как» или «Загрузить»).

Дополнительная функция sort_denovo_primers.py — это поиск прямых и обратных пар праймеров, которые дают ампликоны предсказанного диапазона размеров (некоторые технологии секвенирования, несмотря на текущие заявления, плохо обрабатывают большие ампликоны, поэтому могут быть предпочтительны ампликоны меньшего размера). Для получения точных прогнозов необходимо предоставить стандартный файл выравнивания для generate_primers_denovo.py. См. Параметр -a в разделе руководства для создания праймеров de novo.

Следующая команда сравнивает файл праймера de novo final_denovo_primers.txt в файл известных праймеров known_primers.txt, а также генерирует файл, содержащий ампликоны, предположительно содержащие от 200 до 400 пар оснований:

 sort_denovo_primers.py -i final_denovo_primers.txt -a 200: 400 -k known_primers.txt 

Будет сгенерирован тот же файл formatted_primers.txt и primers_details.txt, который работает с настройками по умолчанию. Также должны присутствовать два дополнительных файла, amplicon_len_pairs.txt и primers_overlap.txt. Усеченный вывод primers_overlap.txt следующий:

 # Уникальные праймеры, которые не перекрывают и не разделяют 3'-концы с известными праймерами
#primer name  последовательность праймера
387f CTGAYSCAGCRAYGCCGCGT
325f GAGACACGGCCCAGACTCCT
326f AGACACGGCCCAGACTCCTA
<снип>
# Грунтовки внахлест с известными грунтовками.
# название праймера  последовательность праймера  известное название праймера  известная последовательность праймера  перекрывающаяся последовательность
347f GGGAGGCAGCAGTGRGGAAT 338r GCTGCCTCCCGTAGGAGT GCTGCCTCCC
331f CGGCCCAGACTCCTACGGGA 338r GCTGCCTCCCGTAGGAGT TCCCGTAGGA
507f GCTAACTMCGTGCCAGCAGC 515f GTGCCAGCMGCCGCGGTAA GTGCCAGCAG
340f CTCCTACGGGAGGCAGCAGT 338r GCTGCCTCCCGTAGGAGT GCTGCCTCCC
332f GGCCCAGACTCCTACGGGAG 338r GCTGCCTCCCGTAGGAGT CTCCCGTAGG
509f TAACTMCGTGCCAGCAGCCG 515f GTGCCAGCMGCCGCGGTAA GTGCCAGCAG
<снип>
# Праймеры, разделяющие 3'-концы с известными праймерами.# название праймера  последовательность праймера  известное название праймера  известная последовательность праймера
359r CTGCTGCCTCCCGTAGGAGT 338r GCTGCCTCCCGTAGGAGT 

Primers_overlap.txt состоит из трех компонентов; первый раздел содержит праймеры, которые не перекрываются с поставляемыми известными праймерами, второй раздел содержит праймеры с частичным перекрытием, а последний раздел содержит праймеры, которые перекрываются и имеют совпадающие 3 ’концы. В этом случае наши праймеры de novo нашли точное совпадение с праймером 338r.Несоответствие индексов (359 для праймера de novo против 338) связано с тем, что 338r назван в честь 3 ’положения праймера, а не положения 5’. Primer Prospector использует 5’-положение праймера, прямое или обратное, для обозначения праймеров, но это не обязательно согласуется с праймерами из других источников, поэтому будьте осторожны. Длина последовательности по умолчанию для «достижения» частичного перекрытия составляет 10 пар оснований, которые можно модулировать с помощью параметра -m при использовании sort_denovo_primers.ру.

Ниже приведен частичный список файла amplicon_len_pairs.txt. В этом файле показаны пары праймеров, соответствующие критериям длины ампликона (в данном случае от 200 до 400 пар оснований). Обратите внимание, что мы определяем ампликоны как расстояние между 3 ’положением праймеров и не включаем длину праймера в расчеты размера ампликона.

 # Пары праймеров в пределах предполагаемого размера ампликона
# Мин. Размер: 200
# Максимальный размер: 400

325f GAGACACGGCCCAGACTCCT
568r CARTAAWTCCGRAYAACGCT
Предполагаемый размер ампликона: 203

325f GAGACACGGCCCAGACTCCT
569r CCARTAAWTCCGRAYAACGC
Предполагаемый размер ампликона: 204
 

Трубопровод для анализа праймеров

Подрезка грунтовки

Базовым модулем конвейера анализа праймеров является analysis_primers.ру. Этот модуль принимает входные праймеры и файл (ы) fasta и оценивает праймеры для каждой последовательности в файле (ах) fasta. Сводные графики прогнозируемой эффективности праймера создаются вместе с файлами «совпадений», в которых записывается оценка праймера и другие детали для каждой последовательности.

Для запуска analysis_primers.py нужны невыровненные файлы fasta. Не выровненные версии бактериальных и архейных последовательностей, используемых в учебнике de novo , доступны здесь и здесь (щелкните правой кнопкой мыши и выберите «Сохранить как» или «Загрузить»).

Кроме того, необходимо предоставить файл, содержащий праймеры в правильном формате, или вручную указать праймер для использования. Формат файла праймеров состоит из названия праймера, за которым следует «f» или «r» (например, 27f), за которым следует табуляция, за которой следует последовательность праймера (от 5 ’до 3’). Пример файла праймеров в нужном формате можно скачать здесь (щелкните правой кнопкой мыши и выберите «Сохранить как» или «Загрузить»). primers.txt содержит три праймера, два из которых взяты из литературы (27f, 388r), а один — праймер, созданный Primer Prospector во время учебного курса de novo (325f).Чтобы проверить эти праймеры на бактериальные последовательности, используйте следующую команду:

 analysis_primers.py -f sample_bacteria_seqs_unaligned.fasta -P primers.txt 

Для каждого праймера создается сводный график и файл «hits.txt». График выходных данных для праймера de novo 325f показан ниже:

На этом графике показаны основные сведения о тестируемых праймерах и последовательностях, а также параметры оценки для окончательной взвешенной оценки, перечисленные в нижней части графика.Взвешенные оценки дают более высокие штрафы для праймеров, которые плохо соответствуют последовательности в 3 ’области праймера. Можно модулировать эти параметры оценки, включая длину 3’-области праймера. Чтобы установить длину 3 ’на 8 пар оснований, штраф за 3’ несовпадения на 1,2 и штраф за несовпадения без 3 ’на 0,5, используйте следующую команду:

 analysis_primers.py -f sample_bacteria_seqs_unaligned.fasta -P primers.txt -e 8 -t 1,2 -T 0,5 

Для каждого протестированного файла праймера и fasta будет создан файл «совпадений», содержащий данные оценки для каждой последовательности.Ниже приведен файл частичных совпадений для праймера 325f (с использованием измененных параметров оценки, приведенных выше):

 # Праймер: 325f 5'-GAGACACGGCCCAGACTCCT-3 '
# Входной файл fasta: sample_bacteria_seqs_unaligned.fasta
# Параметры
# 3 'длина: 8
Штраф за несоответствие, отличное от 3 ': 0,50 за несоответствие
Штраф за несоответствие # 3: 1,20 за несоответствие
# штраф за последнее базовое несоответствие: 3,00
# Штраф за разрыв, отличный от 3 ': 1,00 за разрыв
Штраф за разрыв # 3: 3,00 за разрыв
# Примечание - совпадение последовательности и совпадение праймера являются наилучшими результатами локального попарного выравнивания для данной пары последовательности и праймера.Разрыв в совпадении seq представляет собой делецию в последовательности, тогда как разрыв в совпадении праймера означает вставку в целевую последовательность.
#
# seq ID, совпадение seq, совпадение праймера, начальная позиция совпадения, несовпадения не 3 ', несовпадения 3' (кроме последней базы), несовпадение последней базы, пробелы не 3 ', пробелы 3', общая взвешенная оценка, конец последовательности совпадений
11544, GAGACACGGCCCAGACTCCT, GAGACACGGCCCAGACTCCT, 293,0,0, Ложь, 0,0,0.0, Ложь
57484, GAGACACGGACCAGACTCCT, GAGACACGGCCCAGACTCCT, 288,1,0, Ложь, 0,0,0.5, Ложь
103547, GAGACACGGCCCAGACTCCT, GAGACACGGCCCAGACTCCT, 316,0,0, Ложь, 0,0,0.0, ложь
 

Эти файлы совпадений используются во многих последующих этапах анализа праймеров. Подробнее о формате этого файла см. В документации.

Несколько целевых последовательностей fasta можно протестировать с помощью Analyst_primers.py, разделив входные файлы fasta двоеточием. Чтобы протестировать как бактериальные, так и архейные последовательности, используемые в конвейере de novo с параметрами оценки по умолчанию, используйте следующую команду:

 analysis_primers.py -f sample_bacteria_seqs_unaligned.fasta: sample_archaeal_seqs_unaligned.fasta -P primers.txt 

В дополнение к исходным бактериальным графам и файлам совпадений для каждого праймера будут созданы графы архей и файлы совпадений. График архей для праймера 325f представлен ниже.

Поскольку этот праймер был разработан таким образом, чтобы не совпадать с этими двумя последовательностями архей, по крайней мере, на 3 ’конце, ожидается плохая оценка праймеров этих последовательностей архей.

Можно вручную ввести последовательность праймера вместо ввода текстового файла.Чтобы вручную ввести последовательность праймера, необходимо ввести название праймера (-p) и последовательность (-ы). Пример команды, использующей праймер 338r, показан ниже (обратите внимание, что названия праймеров должны оканчиваться на «f» или «r», а последовательность должна быть написана от 5 ’к 3’):

 analysis_primers.py -f sample_bacteria_seqs_unaligned.fasta -p 338r -s GCTGCCTCCCGTAGGAGT 
Генерация ампликонов и считывание

Ампликоны (определяемые здесь как область последовательности между 3′-концами пары праймеров) или считывания (обычно частичные фрагменты ампликонов, которые секвенированы с помощью технологии 454 или Illumina с одного конца ампликона) для пар праймеров могут быть сгенерированы с помощью скрипт get_amplicons_and_reads.ру. Ампликоны, созданные из этого модуля, можно использовать для визуализации предсказанных размеров ампликонов, а считывания можно использовать для прогнозирования таксономической полезности конкретного ампликона и того, какой праймер следует секвенировать для получения оптимальных результатов.

Генерация ампликонов и считываний основывается на данных праймеров и баллах, содержащихся в файлах совпадений, созданных с помощью analysis_primers.py. Эти файлы совпадений содержат местоположение праймера для каждой последовательности и баллы для указанного праймера (т.е. ожидание того, что праймер успешно амплифицирует данную последовательность).Предполагается, что праймеры, которые плохо работают, не будут производить ампликоны и не будут включены в выходные ампликоны и считывания, чтобы избежать возможных отклоняющихся результатов.

Для генерации ампликонов образцов и считываний требуются файлы совпадений и невыровненные последовательности fasta. Здесь доступен образец бактериального файла fasta (щелкните правой кнопкой мыши и выберите «Сохранить как» или «Загрузить»), а также файл совпадений праймеров 27f и файл совпадений праймеров 338r.

Для создания ампликонов и считываний из пары праймеров 27f и 388r используйте следующую команду:

 get_amplicons_and_reads.py -f sample_bacteria_seqs_unaligned.fasta -i 27f_sample_bacteria_seqs_unaligned_hits.txt: 338r_sample_bacteria_seqs_unaligned_hits.txt 

Это создает два файла: 27f_338r_amplicons.fasta и 27f_338r_r_250_reads.fasta. При настройках по умолчанию для оценки праймеров только 12 из исходных 18 последовательностей включаются в качестве ампликонов и считываются. Кроме того, генерируются только обратные чтения.

Можно изменить порог оценки (-t), тип (-ы) оценки, размер чтения (-R) и тип сгенерированного чтения (-d).Можно, например, изменить тип оценки на общие несоответствия вместо использования взвешенной оценки, установить порог для включения на 6 (т. Е. 6 несовпадений), сгенерировать 100 считываний пар оснований и получить считывания как с прямого, так и с обратного праймеров с помощью следующая команда:

 get_amplicons_and_reads.py -f sample_bacteria_seqs_unaligned.fasta -i 27f_sample_bacteria_seqs_unaligned_hits.txt: 338r_sample_bacteria_seqs_unaligned_hits.txt -t 6 -s total_mismatches -R 100 -d p 900

 

Это сгенерирует три файла: 27f_338r_amplicons.fasta, 27f_338r_f_100_reads.fasta (прямое чтение) и 27f_338r_r_100_reads.fasta (обратное чтение). Из-за менее строгих настроек 13 из 18 исходных последовательностей будут включены в ампликоны и считывания. Остальные 5 последовательностей не записываются, поскольку результаты нелогичны (прямой праймер настолько плохо совпадает с последовательностью, что его лучшее совпадение находится ниже обратного праймера).

Гистограммы ампликонов

Визуальное отображение предсказанных размеров ампликонов может быть полезно для определения жизнеспособности данной пары праймеров, учитывая, что технология секвенирования имеет ограничения на размер ампликонов, которые могут быть считаны.Модуль amplicons_histograms.py будет генерировать графики, показывающие размеры ампликонов, для быстрой оценки размера и дисперсии предсказанных ампликонов. Примечание. Здесь не указаны размеры используемых праймеров, штрих-кодов или адаптеров.

В этом руководстве можно использовать образец файла ампликонов (щелкните правой кнопкой мыши и выберите «Сохранить как» или «Загрузить»).

Для создания гистограммы используйте следующую команду:

 amplicons_histograms.py -f 27f_338r_amplicons.fasta 

График, подобный показанному ниже, покажет размеры предсказанных ампликонов.

Разделение ампликонов по областям жизни может быть полезным, особенно если включены эукариотические организмы. amplicons_histograms.py разделит ампликоны в соответствии с областью жизни, если включен файл сопоставления таксономии. Образец файла сопоставления таксономии можно загрузить здесь (щелкните правой кнопкой мыши и выберите «Сохранить как» или «Загрузить»). Чтобы использовать этот файл сопоставления таксономии, используйте следующую команду:

 amplicons_histograms.py -f 27f_338r_amplicons.fasta -t taxonomy_mapping.txt 
Оценка таксономической полезности чтений
Последовательности

, которые являются высококонсервативными, не особенно полезны с точки зрения таксономического определения филогенетического анализа. taxa_assignment_report.py назначит таксономию группе чтений и, сравнивая с известными таксономиями, сгенерирует отчет о точности и глубине этих назначений. Для получения дополнительной информации о создании считываний из предполагаемых праймеров см. Создание ампликонов и считываний.

В настоящее время для таксономического назначения реализован только классификатор RDP.

Для

taxa_assignment_report.py требуется файл сопоставления таксономии, и последовательность читает файл (щелкните правой кнопкой мыши и выберите «Сохранить как» или «Загрузить») в формате fasta. Таксономическое присвоение может быть медленным, особенно для большого количества последовательностей.

Чтобы запустить этот модуль с файлами примеров, используйте следующую команду:

 taxa_assignment_report.py -t taxonomy_mapping.txt -f 27f_338r_r_250_reads.fasta 

Этот модуль сгенерирует два файла, 27f_338r_r_250_reads_accuracy_report.txt и 27f_338r_r_250_reads_assignments.txt.

Назначения чтения будут в следующем формате, где за идентификатором последовательности в файле чтения следует таксономическое присвоение и оценка достоверности:

 254376 Корень; бактерии; Firmicutes; «Clostridia»; Clostridiales; «Lachnospiraceae»; Roseburia 0,990
256904 Корень; Бактерии 0,990
339039 Корень; бактерии; протеобактерии 0,850
300253 Корень; Бактерии; Фирмикуты; "Clostridia"; Clostridiales; "Ruminococcaceae" 0,980
300250 Корень; Бактерии; Фирмикуты; "Clostridia"; Clostridiales 0.960
 

Файл 27f_338r_r_250_reads_accuracy_report.txt показывает точность присвоений и точность нисходящих уровней таксономических глубин (т. Е. Более конкретная категоризация на уровне типа, класса, семейства и т. Д.).

 # Файл отчета о присвоении таксономии
# Этот отчет начинается на самом высоком уровне таксонов (т. Е. На уровне домена)
# и перечисляет точность назначения и количество последовательностей
# с таксономическим назначением и таксономическим картированием на эту глубину
# Файл Fasta, используемый для таксономических назначений: 27f_338r_r_250_reads.Fasta
# Метод присвоения: rdp
# Начать отчет о точности данных
# Уровень таксонов, процентная точность присвоения, количество последовательностей с таксонами, определенными на этом уровне
0,100,000,12
1,100,000,9
2,62.500,8
Последовательности без соответствующего идентификатора в файле сопоставления таксономии: 0
Последовательности, назначенные только как «Корневые»: 0 

Обратите внимание на то, что как точность присвоения, так и количество последовательностей, определенных на уровнях 1 (тип) и 2 (класс), ниже уровня 0 (домен). Определенные таксоны на данном уровне зависят как от назначения, так и от входного файла сопоставления таксономии.Сообщаемую таксономическую глубину можно увеличить с помощью параметра -d.

Оптимизирующие праймеры
Праймеры

можно оптимизировать для повышения чувствительности или снижения ненужного вырождения с помощью модуля optimize_primers.py.

Этот модуль использует совпадения целевой последовательности из файлов совпадений праймеров, сгенерированных с помощью анализатора_primers.py, для создания выходного файла с выделенными вкладками, содержащего базовые частоты для каждой позиции в праймере. В этом примере файл совпадений праймеров 27f (щелкните правой кнопкой мыши и выберите «Сохранить как» или «Загрузить») используется для демонстрации выходных данных optimize_primers .

Чтобы запустить этот модуль с настройками по умолчанию, используйте следующую команду:

 optimize_primers.py -i 27f_sample_bacteria_seqs_unaligned_hits.txt 

Это создает файл с именем 27f_sample_bacteria_seqs_unaligned_hits_base_frequencies.txt , который содержит следующее:

 # Отчет о базовой частоте для оптимизации праймеров
# Этот файл разделен табуляцией для удобства импорта в Excel или другие электронные таблицы
# Вырожденные коды ДНК (перечислены здесь для удобства): R = AG, Y = CT, M = AC, K = GT, W = AT, S = CG, B = CGT, D = AGT, H = ACT, V = ACG , N = ACGT
# Праймер указан в ориентации от 5 до 3 футов.# Файл обращений, используемый для генерации данных базовой частоты: 27f_sample_bacteria_seqs_unaligned_hits.txt
# Используемый тип оценки: weighted_score
# Порог оценки: 2
# Последовательность праймера: AGAGTTTGATCMTGGCTCAG
#
Грунтовка A G A G T T T G A T C M T G G C T C A G
База
А 1,00 0,00 0,91 0,00 0,00 0,00 0,00 0,00 0,91 0,00 0,00 0,36 0,00 0,00 0,00 0,00 0,00 0,00 0.00 1,00 0,00
Т 0,00 0,00 0,00 0,00 1,00 0,91 1,00 0,09 0,09 1,00 0,27 0,00 1,00 0,00 0,00 0,00 0,00 1,00 0,00 0,00 0,00
С 0,00 0,00 0,00 0,00 0,00 0,09 0,00 0,00 0,00 0,00 0,73 0,64 0,00 0,00 0,00 1,00 0,00 1,00 0,00 0,00
G 0,00 1,00 0,09 1,00 0,00 0,00 0,00 0,91 0,00 0,00 0,00 0,00 0,00 1,00 1,00 0,00 0,00 0,00 0.00 1,00 

Этот образец выходного файла можно загрузить здесь (щелкните правой кнопкой мыши и выберите «Сохранить как» или «Загрузить»).

В этом примере «C» в позиции основания 11 праймера можно было бы изменить на «Y», что повысило бы чувствительность праймера, поскольку 27% последовательностей имеют «T» в этом положении.

Создание линкеров

Линкеры, обычно 2 последовательности пар оснований между 5 ’концом праймера и штрих-кодом или адаптером, могут быть сгенерированы с помощью generate_linkers.py модуль. Основания, которые в наименьшей степени дополняют целевые последовательности, приведены в качестве предлагаемых линкеров. Для создания линкеров требуется файл совпадений (см. Оценка праймеров) и последовательности fasta, используемые для создания этого файла совпадений. В этом руководстве можно использовать образец файла праймера 338r и бактериальный файл fasta (щелкните правой кнопкой мыши и выберите «Сохранить как» или «Загрузить»).

Чтобы сгенерировать предлагаемые компоновщики с этими примерами файлов, используйте следующую команду:

 generate_linkers.py -i 338r_sample_bacteria_seqs_unaligned_hits.txt -f sample_bacteria_seqs_unaligned.fasta 

Будет создан один файл с именем 338r_sample_bacteria_seqs_unaligned_hits_suggested_linkers.txt, который содержит следующее:

 # Сводные данные для предлагаемых линкеров
# Обратите внимание: вырожденные базы игнорируются для результатов компоновщика, как и компоновщики, которые
# превышает длину входной последовательности fasta. Базовая позиция начинается с
# 5 'позиция компоновщика, поэтому позиция 0 будет 5' самой базовой
# компоновщик, позиция 1 будет следующей базой и так далее.Файл обращений, используемый для создания линкеров: 338r_sample_bacteria_seqs_unaligned_hits.txt
Используемый тип оценки: weighted_score
основной порог: 1

Базовая позиция 0
A: 0,000 T: 0,000 C: 1,000 G: 0,000
Базовая позиция 1
A: 0,000 T: 1,000 C: 0,000 G: 0,000

Предлагаемая последовательность линкера:
AA
Худшая линкерная последовательность:
CT 

Эти предлагаемые линкеры написаны в направлении 5 ’-> 3’, и их следует размещать на 5 ’конце данного праймера. В приведенном выше примере мы использовали праймер 338r (5’-GCTGCCTCCCGTAGGAGT-3 ’).Полный предлагаемый линкер и праймер будет (5’-AAGCTGCCTCCCGTAGGAGT-3 ’).

Прогнозирование таксономического охвата

Чтобы легко визуализировать прогнозируемый таксономический охват данного праймера или пары праймеров, используйте модуль taxa_coverage.py. Для этого модуля требуется файл совпадений (см. Оценка праймеров) и файл сопоставления таксономии. В этом руководстве можно использовать пример файла совпадений и сопоставления таксономии (щелкните правой кнопкой мыши и выберите «Сохранить как» или «Загрузить»). Дополнительные сведения о форматах файлов Primer Prospector см. В документации.

В этом примере мы будем использовать праймер 27f, обычный праймер, используемый для бактериальных анализов.

Для создания сводного файла таксономического покрытия и графиков используйте следующую команду:

 taxa_coverage.py -i 27f_sample_bacteria_seqs_unaligned_hits.txt -T taxonomy_mapping.txt 

В текущем каталоге будет создана папка с именем 27f_sample_bacteria_seqs_unaligned_hits_primer_coverage. В этой папке будут три графика, файл журнала и 27f_sample_bacteria_seqs_unaligned_hits_coverage.txt текстовый файл. Графики будут для уровней таксономии 0, 1 и 2 (домен, тип и класс соответственно). Бактерии - единственная категория для диаграммы уровня домена, поскольку в эти файлы примеров не были включены археи или эукарии. Ожидаемый выходной график для покрытия домена показан ниже:

Это показывает, что примерно 60% из 18 последовательностей, как ожидается, будут амплифицированы праймером 27f. Уровень таксономии 1 или уровень филума показан следующим образом:

И, наконец, уровень таксономии 2, уровень класса:

Также создается текстовый файл, разделенный запятыми, содержащий те же самые данные, для легкой вставки в программу электронных таблиц.Ниже показано содержимое файла 27f_sample_bacteria_seqs_unaligned_hits_coverage.txt:

 # Этот файл записан с убывающими уровнями таксономической глубины
# Каждая строка начинается с уровнем таксономии, за которым следует первый уровень
# таксономия для данной последовательности, как правило, домена, после таксономии
# для текущего уровня.
# Сначала перечислены общие последовательности для данной таксономии, затем
# процент, который ниже или равен пороговому баллу для прохождения.# уровень таксономии, таксономия первого уровня, классификация таксономии для текущего уровня, общее количество последовательностей для данной классификации, процент проходных баллов последовательностей
0, Бактерии, Бактерии, 18,0.6667
1, Бактерии, Протеобактерии, 5,0.6000
1, Бактерии, Фирмикуты, 5,0.6000
1, Бактерии, Bacteroidetes, 1,1.0000
1, Бактерии, Chloroflexi, 1,1,0000
1, Бактерии, Deferribacteres, 1,0,0000
1, Бактерии, Хлороби, 1,1,0000
1, Бактерии, Актинобактерии, 2,0,5000
1, Бактерии, Цианобактерии, 1,1.0000
2, Бактерии, гаммапротеобактерии, 3,0.6667
2, Бактерии, Сфингобактерии, 1,1.0000
2, Бактерии, Alphaproteobacteria, 1,1,0000
2, Бактерии, «клостридии», 4,0.7500
2, Бактерии, Anaerolineae, 1,1.0000
2, Бактерии, Deferribacteres, 1,0,0000
2, Бактерии, Эпсилонпротеобактерии, 1,0,0000
2, Бактерии, Хлоробии, 1,1,0000
2, Бактерии, «бациллы», 1,0,0000
2, Бактерии, Актинобактерии, 2,0,5000
2, Бактерии, Цианобактерии, 1,1,0000
 

Глубину предоставленной таксономии можно модулировать, но это зависит от глубины, определенной во входном файле сопоставления таксономии. Также может быть проанализирована пара праймеров.В этом случае для каждой последовательности в файле совпадений для каждого праймера (они должны быть созданы против одних и тех же целевых последовательностей) худшая оценка из двух для пары праймеров определяет, будет ли данная пара праймеров успешно амплифицировать данную последовательность. Файл обращений 338r можно скачать здесь, чтобы продемонстрировать использование нескольких файлов обращений с этим модулем.

По умолчанию взвешенная оценка (которая учитывает 3 ’несовпадения более чем 5’ несовпадений) используется для определения того, будет ли праймер амплифицироваться.Вместо этого можно использовать другой метод оценки, например, общие несоответствия.

Чтобы протестировать пару праймеров 27f и 338r (-p включает тестирование пары праймеров) с использованием общих несоответствий вместо взвешенной оценки, используйте следующую команду:

 taxa_coverage.py -i 27f_sample_bacteria_seqs_unaligned_hits.txt: 338r_sample_bacteria_seqs_unaligned_hits.txt -T taxonomy_mapping.txt -p -s General_mismatches 

Эта команда сгенерирует папки для каждого отдельного праймера, а также объединенный результат в папке 27f_sample_bacteria_seqs_unaligned_hits_338r_sample_bacteria_seqs_unaligned_hits_primers_coverage.Эта папка будет содержать те же графики и текстовый файл, которые были описаны ранее для отдельного праймера, с описанным выше методом подсчета очков для пары праймеров, определяющих результаты.

Тестирование вторичной структуры штрих-кода и праймера

При анализе большого количества образцов часто необходимо использовать штрих-коды для различения и демультиплексирования последовательностей ДНК. Вторичная структура и / или димеры праймеров могут мешать ПЦР. check_primer_barcode_dimers.py может отфильтровывать штрих-коды, которые будут формировать вторичную структуру с праймерами, и обнаруживать димеризацию праймеров.

Для использования этого модуля пользователь должен предоставить текстовый файл, содержащий штрих-коды, файл параметров энергии сворачивания ДНК, а также два праймера, которые будут использоваться во время ПЦР. Чтобы избежать путаницы с прямыми и обратными праймерами, мы будем называть праймер, связанный со штрих-кодом «праймером 1», а другой праймер «праймером 2». Если между штрих-кодом и праймером используются линкеры, они должны быть включены в последовательность праймера, чтобы можно было протестировать полную последовательность 5’-штрих-код-линкер-праймер-3 ’.Файл параметров ДНК, dna_DM.par, можно найти в папке DNA_parameters программы Primer Prospector или загрузить здесь (щелкните правой кнопкой мыши и выберите «Сохранить как» или «Загрузить»). Это файл измененной формы параметров ДНК из программы структуры РНК Дэвида Мэтьюса.

Пример файла со штрих-кодом можно загрузить здесь (щелкните правой кнопкой мыши и выберите «Сохранить как» или «Загрузить»). Содержимое этого файла показано ниже.

 # Примеры штрих-кодов для тестирования check_primers_barcode_dimers.py
ATCGATTACGAC
CGGAGGACGATT
CAGCATACGATC
CGAAATACAGAC
 

Комментарии к этому файлу начинаются с символа решетки (#).Каждый штрих-код располагается в отдельной строке, и на него будет ссылаться в соответствии со строкой, в которой он был обнаружен в выходных данных этого модуля (первый штрих-код находится в строке 0, второй - в строке 1 и т. Д.).

В первом примере мы будем использовать последовательность ACTCGTAGACGATTGACGGACT для праймера 1 и CAGGACGATTAACGATTAC для праймера 2. В этом примере мы предположим, что последовательность из двух пар оснований AC в начале праймера 1 является линкерной последовательностью, поэтому первая последовательность штрих-код-линкер-праймер, протестированная модулем, будет ATCGATTACGACACTCGTAGACGATTGACGGACT.Используйте следующую команду (при условии, что файлы test_barcodes.txt и dna_DM.par были загружены в текущий каталог):

 check_primer_barcode_dimers.py -p ACTCGTAGACGATTGACGGACT -P CAGGACGATTAACGATTAC -b test_barcodes.txt -e dna_DM.par 

Будет сгенерировано два файла: barcode_results.txt и filter_barcodes.txt.

Далее следует содержимое файла barcode_results.txt:

 # Комбинации штрих-кода / праймера, которые не достигают энергетического порога.# primer1 и primer2 будут перечислены во всех невырожденных формах, которые приводят к значениям энергии ниже порогового значения.
# Если primer2 не имеет штрих-кода, он будет протестирован против самого себя один раз и будет указан первым с пустыми полями индекса штрих-кода и последовательности.
# номер строки штрих-кода из входного файла штрих-кода, последовательность штрих-кода, идентичность праймера1, идентичность праймера2, комбинированная последовательность, вторичная структура, энергия Гиббса в ккал / моль
Комбинации штрих-код / ​​праймер ниже указанного энергетического порога обнаружены не были. 

В этом случае все комбинации праймеров и штрих-кодов подходят для использования в ПЦР, поскольку ни одна из них не имеет особенно стабильной вторичной структуры (энергия Гиббса ниже значения по умолчанию -10.0 ккал / моль, который можно модулировать параметром -s).

Файл filter_barcodes.txt содержит следующее:

 # Следующие штрих-коды не были отмечены для какой-либо потенциальной вторичной структуры с данными праймерами.
ATCGATTACGAC
CGGAGGACGATT
CAGCATACGATC
CGAAATACAGAC
 

Он содержит все те же штрих-коды, что и входной файл test_barcodes.txt, что означает, что все они подходят для использования. Если бы какой-либо штрих-код был помечен как вторичная структура, он бы не появился в этом файле.

Чтобы увидеть результат комбинации праймер-штрих-код, которая действительно приводит к вторичной структуре, давайте воспользуемся последовательностью GACCCTACGAGTCCTCGTCCTCCGA для праймера 2.

 check_primer_barcode_dimers.py -p ACTCGTAGACGATTGACGGACT -P GACCCTACGAGTCCTCGTCCTCCGA -b test_barcodes.txt -e dna_DM.par 

В данном случае файл barcode_results.txt содержит следующее:

 # Комбинации штрих-кода / праймера, которые не достигают энергетического порога.
# primer1 и primer2 будут перечислены во всех невырожденных формах, которые приводят к значениям энергии ниже порогового значения.# Если primer2 не имеет штрих-кода, он будет протестирован против самого себя один раз и будет указан первым с пустыми полями индекса штрих-кода и последовательности.
# номер строки штрих-кода из входного файла штрих-кода, последовательность штрих-кода, идентичность праймера1, идентичность праймера2, комбинированная последовательность, вторичная структура, энергия Гиббса в ккал / моль
1, CGGAGGACGATT, Primer1, Primer2, CGGAGGACGATTACTCGTAGACGATTGACGGACT ---------- GACCCTACGAGTCCTCGTCCTCCGA, ((((((((((.. ((((((((......... ...................)))))))) ..))))))))))., - 12.97 

Второй штрих-код, найденный в строке 1, помечен как вторичная структура.Последовательности (дефисы представляют, вторичная структура и значения энергии хранятся в этом файле. В файле filter_barcodes.txt теперь удален второй штрих-код (строка 1):

 # Следующие штрих-коды не были отмечены для какой-либо потенциальной вторичной структуры с данными праймерами.
ATCGATTACGAC
CAGCATACGATC
CGAAATACAGAC
 

Пользователь может захотеть пропустить любые подробности о штрих-кодах, которые, по прогнозам, будут плохо работать, и может просто скопировать отфильтрованные штрих-коды в filter_barcodes.txt в электронную таблицу для использования. Однако, чтобы облегчить визуализацию вторичной структуры для любопытного пользователя, для каждого штрих-кода-праймера, помеченного как вторичная структура, создается файл postscript. В этом случае в текущем каталоге создается файл Line1_CGGAGGACGATT_primer1V0_primer2V0.ps. Он показан ниже (обратите внимание, что символы «T» отображаются как «U» в выходных файлах postscript пакета венской РНК):

check_primer_barcode_dimers.py также может обрабатывать вырожденные праймеры.Например, если мы используем последовательность ACTCGTAGACGATTGRCGGACT для праймера 1, одна из возможных последовательностей праймеров и штрих-кодов будет помечена как вторичная структура. Используйте следующую команду, чтобы увидеть это:

 check_primer_barcode_dimers.py -p ACTCGTAGACGATTGRCGGACT -P CAGGACGATTAACGATTAC -b test_barcodes.txt -e dna_DM.par 

barcode_results.txt показывает вариант праймера 1, который самодимеризуется и приводит к вторичной структуре с одним из штрих-кодов (в данном случае первый штрих-код ATCGATTACGAC и вариант праймера 1 ACTCGTAGACGATTGGCGGACT):

 0, ATCGATTACGAC, Primer1, Primer1, ATCGATTACGACACTCGTAGACGATTGGCGGACT ---------- ATCGATTACGACACTCGTAGACGATTGGCGGACT ,........ ((. ((. ((((.. ((((. ((. ((. (. (.............).) .)).)).)))) ..)))).)).)) ...., - 11.42 

Если несколько форм вырожденного праймера привели к вторичной структуре, каждая из них была бы указана в отдельной строке в файле barcode_results.txt.

Расчет температуры плавления

Primer Prospector в настоящее время не рассчитывает температуру плавления грунтовок, хотя в будущем может быть добавлена ​​поддержка. А пока мы рекомендуем использовать такую ​​программу, как TmCheck, которая предоставляет несколько методов расчета температуры плавления.

Пример из реального мира

Следующий пример демонстрирует, почему пара праймеров 515f и 806r была выбрана для исследований на основе SSU с участием бактерий и архей. Это не исчерпывающая иллюстрация процесса, а просто подмножество, но предназначена для демонстрации использования общедоступных баз данных последовательностей для анализа праймеров.

В статье Primer Prospector ( PrimerProspector: de novo design и таксономический анализ праймеров для ПЦР. Walters, Caporaso et al.), база данных Silva использовалась для создания графиков, показанных на рисунке 1, и дополнительных материалов. В этом руководстве будет использоваться база данных Greengenes, поскольку она включает таксоны (археи и бактерии), которые нас интересовали. Эта версия набора последовательностей Greengenes будет использовать возможность модуля taxa_assignment_report.py для повторного обучения RDP классификатор в новом наборе данных и файл сопоставления таксономии, который также можно переобучить для использования наборов данных эукариот.

Загрузите здесь Greengenes 97 OTU (щелкните правой кнопкой мыши и выберите «Сохранить как» или «Загрузить»), которые содержат файл greengenes fasta, используемый ниже.Файл сопоставления таксономии, совместимый с RDP, можно загрузить здесь (щелкните правой кнопкой мыши и выберите «Сохранить как» или «Загрузить»).

Текстовый файл с праймерами, использованными в этих примерах, можно скачать здесь (щелкните правой кнопкой мыши и выберите «Сохранить как» или «Загрузить»).

Праймеры для задира

Чтобы оценить все праймеры в файле Primers.txt, введите следующую команду (обратите внимание, что пути к входным файлам могут различаться в зависимости от того, где они были загружены и распакованы):

 analysis_primers.py -P Primers.txt -f gg_otus_29nov2010 / rep_set / gg_97_otus_29nov2010.fasta -v 

Будет сгенерирован сводный график postscript и файл совпадений для каждого из восьми праймеров в файле Primers.txt. На заполнение каждой грунтовки уйдет примерно 10 минут.

Результаты для праймеров 515f и 27f показаны ниже.

Обратите внимание, что оценки праймера 27f хуже прогнозов, показанных на рисунке S2 в статье Primer Prospector. Это связано с частичными последовательностями SSU в базе данных (т.е.е. последовательности были созданы с праймером 27f, которые были удалены из последовательности перед отправкой в ​​базу данных). Это проблема при анализе праймеров на концах последовательностей, которую можно смягчить, используя фильтр длины для последовательностей (менее строгий) или используя выравнивание последовательностей для поиска и сохранения только последовательностей, которые находятся в положении праймера или за ним. (более строгие). Хотя Primer Prospector не автоматизирует этот процесс фильтрации последовательностей, он записывает праймеры, которые примыкают к концу последовательности, что может помочь в поиске выравнивания для определенной позиции нуклеотида (дополнительные сведения о формате файла совпадений см. В документации).

Ниже приведены результаты необработанных результатов праймера 1100r:

У этого праймера есть ряд проблем из-за большого количества несовпадений. Такие праймеры можно оптимизировать, используя модуль optimize_primers.py, который можно запустить на этом праймере с помощью следующей команды (параметр -t 4 позволяет нам записывать базовые частоты более низкоэффективных праймеров):

 optimize_primers.py -i 1100r_gg_97_otus_29nov2010_hits.txt -t 4 

Будет создан файл с именем 1100r_gg_97_otus_29nov2010_hits_base_frequencies.txt

 # Отчет о базовой частоте для оптимизации праймеров
# Этот файл разделен табуляцией для удобства импорта в Excel или другие электронные таблицы
# Вырожденные коды ДНК (перечислены здесь для удобства): R = AG, Y = CT, M = AC, K = GT, W = AT, S = CG, B = CGT, D = AGT, H = ACT, V = ACG , N = ACGT
# Праймер указан в ориентации от 5 до 3 футов.
# Файл обращений, используемый для генерации данных базовой частоты: 1100r_gg_97_otus_29nov2010_hits.txt
# Используемый тип оценки: weighted_score
# Порог оценки: 4
# Последовательность праймера: TGGGTCTCGCTCGTTG
#
Грунтовка T G G G T C T C G C T C G T T G
База
А 0.62 0,00 0,00 0,00 0,00 0,00 0,00 0,00 0,00 0,00 0,00 0,00 0,02 0,00 0,00 0,03
Т 0,04 0,00 0,00 0,00 1,00 0,95 0,08 0,00 0,00 0,01 0,98 0,00 0,00 1,00 1,00 0,00
С 0,01 0,00 0,00 0,02 0,00 0,05 0,00 1,00 0,00 0,99 0,02 1,00 0,00 0,00 0,00 0,00
G 0,33 0,99 1,00 0,98 0,00 0,00 0,92 0,00 1,00 0,00 0,00 0,00 0,98 0.00 0,00 0,96 

Поскольку 3 ’положения праймера особенно важны для амплификации, их можно сделать более вырожденными для повышения производительности. Кроме того , C и T в положениях 5 и 6 можно было бы сделать более вырожденными, чтобы ограничить несовпадения, отличные от 3 ’. Наконец, можно просто удалить 5 'крайнее основание в грунтовке. Исходный и оптимизированный грунт:

 Оригинальный праймер: TGGGTCTCGCTCGTTG
Оптимизированный праймер: GGGTYKCGCTCRTTR 

Результаты оценки оптимизированного праймера следующие:

Эта прогнозируемая производительность намного выше, хотя мы ввели значительную степень вырожденности, которая может привести к неспецифическому целевому связыванию, а также к большому диапазону потенциального содержания GC для различных форм праймера.

Затем давайте сгенерируем ампликоны и предсказанные чтения, чтобы проверить их жизнеспособность. Чтобы сгенерировать полноразмерные ампликоны и обратные чтения 250 пар оснований пары праймеров 515f и 806r, используйте следующую команду:

 get_amplicons_and_reads.py -f gg_otus_29nov2010 / rep_set / gg_97_otus_29nov2010.fasta -i 515f_gg_97_otus_29nov2010_hits.txt: 806r_gg_97_otus_29nov2010_hits.txt -o 515f_ons

 

Выполните ту же команду для пары праймеров 338f и 515r:

 get_amplicons_and_reads.py -f gg_otus_29nov2010 / rep_set / gg_97_otus_29nov2010.fasta -i 338f_gg_97_otus_29nov2010_hits.txt: 515r_gg_97_otus_29nov2010_hits.txt -o 338f_515r_amplicons_reads / 900

 

Затем сгенерируйте гистограммы ампликонов для каждой пары праймеров:

 amplicons_histograms.py -t otu_id_to_greengenes_rdp_train.txt -f 515f_806r_amplicons_reads / 515f_806r_amplicons.fasta -o 515f_806r_amplicons_reads / 
 amplicons_histograms.py -t otu_id_to_greengenes_rdp_train.txt -f 338f_515r_amplicons_reads / 338f_515r_amplicons.fasta -o 338f_515r_amplicons_reads / 

Это создаст следующие графики:

Здесь сделаны два важных прогноза: пара праймеров 515f / 806r будет генерировать более крупные ампликоны с меньшей вариабельностью, чем 338f / 515r, а пара 515f / 806r будет генерировать ампликоны архей.

В выходных папках также будет файл r_250_reads.fasta, созданный для каждой пары праймеров. В случае пары 338f / 515r эта длина чтения больше, чем ампликоны, поэтому результаты усекаются до самих ампликонов.Мы можем оценить, насколько таксономически полезны эти чтения, используя модуль taxa_assignment_report.py . Этот классификатор RDP, который использует этот модуль, можно переобучить на настраиваемых наборах последовательностей и файлах сопоставления таксономии, которые мы будем использовать здесь.

Сначала оценивает обратные 250 пар оснований, считывания пары праймеров 515f-806r:

 taxa_assignment_report.py -t otu_id_to_greengenes_rdp_train.txt -T gg_otus_29nov2010 / rep_set / gg_97_otus_29nov2010.fasta -f 515f_806r_amplicons_reads / 515f_806r_r_250fasta -o 515f_806r_amplicons_reads / -d 5 

Таксономическое присвоение может происходить медленно, поэтому будьте готовы позволить модулю работать в течение 15 минут или более. Затем запустите тот же отчет о назначении пары праймеров 338f / 515r:

 taxa_assignment_report.py -t otu_id_to_greengenes_rdp_train.txt -T gg_otus_29nov2010 / rep_set / gg_97_otus_29nov2010.fasta -f 338f_515r_amplicons_reads / 338f_515r_r_amplicons_reads / 338f_515r_r_ons_r_data_900_reads_reads / 338f_515r_d_r_r_r_250

 

Для последовательностей будут даны таксономические определения, а также _accuracy_report.txt в выходных каталогах. Отчет для 515f / 806r и 338f / 515r следующий:

 # Файл отчета о присвоении таксономии
# Этот отчет начинается на самом высоком уровне таксонов (т. Е. На уровне домена)
# и перечисляет точность назначения и количество последовательностей
# с таксономическим назначением и таксономическим картированием на эту глубину
# Файл Fasta, используемый для таксономических назначений: 515f_806r_r_250_reads.fasta
# Метод присвоения: rdp
# Путь к файлу обучающих данных для классификатора RDP: gg_97_otus_29nov2010.Fasta
# Начать отчет о точности данных
# Уровень таксонов, процентная точность присвоения, количество последовательностей с таксонами, определенными на этом уровне
0,100,000,32198
1,99.956,32107
2,99,944,31970
3,99,813,31606
4,98,727,30475
Последовательности без соответствующего идентификатора в файле сопоставления таксономии: 0
Последовательности, назначенные только как "Корневые": 0

# Файл отчета о присвоении таксономии
# Этот отчет начинается на самом высоком уровне таксонов (т. Е. На уровне домена)
# и перечисляет точность назначения и количество последовательностей
# с таксономическим назначением и таксономическим картированием на эту глубину
# Файл Fasta, используемый для таксономических назначений: 338f_515r_r_250_reads.Fasta
# Метод присвоения: rdp
# Путь к файлу обучающих данных для классификатора RDP: gg_97_otus_29nov2010.fasta
# Начать отчет о точности данных
# Уровень таксонов, процентная точность присвоения, количество последовательностей с таксонами, определенными на этом уровне
0,100,000,31351
1,99.938,30470
2,99,830,30049
3,99,632,28783
4,98,249,26095
Последовательности без соответствующего идентификатора в файле сопоставления таксономии: 0
Последовательности, назначенные только как «Корневые»: 0 

Точность таксономических назначений для этих чтений достаточно высока, что неудивительно, поскольку они охватывают гипервариабельные области (V3 и V4).Однако из-за более коротких размеров чтения для пары 338f / 515r способность классификатора RDP идентифицировать последовательности на более низких уровнях (например, порядок и семейство) падает.

Наконец, давайте исследуем прогнозируемый таксономический охват для этих двух пар праймеров. Чтобы сгенерировать графики таксономического покрытия для этих пар праймеров, используйте следующие команды:

 taxa_coverage.py -i 515f_gg_97_otus_29nov2010_hits.txt: 806r_gg_97_otus_29nov2010_hits.txt -p -T otu_id_to_greengenes_rdp_train.txt -o 515f_806r_taxa_coverage / 
 taxa_coverage.py -i 338f_gg_97_otus_29nov2010_hits.txt: 515r_gg_97_otus_29nov2010_hits.txt -p -T otu_id_to_greengenes_rdp_train.txt -o 338f_515r_taxa_coverage / 900

 

Каждая выходная папка содержит три папки. Две папки содержат результаты для отдельных праймеров, а третья - результаты оценки обоих праймеров. Графики для домена (уровень 0), типа (уровень 1) и класса (уровень 2) создаются с настройками по умолчанию.Глядя на графики уровня домена для каждой пары праймеров, мы видим, что охват для 515f / 806r включает большинство бактерий и архей, наших первоначальных целей.

Это не исчерпывающий список праймеров, протестированных во время нашего поиска универсальных праймеров для архей / бактерий, но он иллюстрирует основные цели нашего поиска (хороший таксономический охват для обоих доменов и длины чтения, которые были достаточно длинными, чтобы быть таксономически информативными, но не настолько большой, чтобы технология секвенирования не могла с ними справиться) и как Primer Prospector помог нам достичь этой цели.

Установка Primer Prospector - Домашняя страница

Primer Prospector состоит из собственного кода и дополнительно содержит множество внешних приложений.

Вследствие этой «конвейерной» архитектуры, в зависимости от функций Primer Prospector, которые вы планируете использовать, вам могут потребоваться или не потребоваться все зависимости Primer Prospector.

Следующие программы необходимы для использования всех функций Primer Prospector.

Вы должны следовать инструкциям, предоставленным разработчиками пакетов, чтобы установить зависимости.

Зависимости, необходимые для Primer Prospector

Для установки большинства следующих зависимостей вам потребуется среда сборки на вашем компьютере. В OS X это включает в себя установку инструментов разработчика. В Linux на основе Debian (например, Ubuntu) это включает в себя установку пакета, необходимого для сборки:

 sudo apt-get install build-essential 

Для Primer Prospector требуется следующее:

  • Python 2.6 (src) (лицензия: PSF)
  • PyCogent 1.5 (src) (лицензия: GPL)
  • Numpy 1.3.0 (src) (лицензия: BSD)
  • Matplotlib 0.98.5.3 (src) (лицензия: BSD)

Чтобы использовать модуль taxa_assignment_report.py, необходимо установить программу назначения таксономии. В настоящее время реализован только классификатор RDP.

Чтобы проверить наличие вторичных структур между штрих-кодами и праймерами с помощью check_primer_barcode_dimers.py, мы используем программное обеспечение для предсказания вторичной структуры Венской РНК со значениями энергии ближайшего соседа ДНК.

Файл параметров ДНК, dna_DM.par, можно найти в папке DNA_parameters программы Primer Prospector. Это файл измененной формы параметров ДНК из программы структуры РНК Дэвида Мэтьюса.

Полезный источник справочных последовательностей и файлов картирования таксономии (в настоящее время только последовательности бактерий и архей):

  • Greengenes 97% OTU, таксономии и дерево (zip)

Silva (src) также имеет источники последовательностей малых субъединиц, включая последовательности эукариот.Однако в настоящее время нет общедоступных файлов сопоставления таксономии в формате, совместимом с Primer Prospector. Последнюю версию выровненных файлов Silva SSU fasta можно найти здесь: (src). Модуль clean_fasta.py в Primer Prospector можно использовать для удаления точек, удаления пробелов и преобразования урациловых символов «U» в символы тимадина «T», что необходимо для таких файлов, как файл Silva fasta, указанный выше.

Если вы планируете создавать документацию Primer Prospector локально:

  • Сфинкс 1.0.4 (src) (лицензия: BSD)

Информация о лицензии для внешних зависимостей

Мы попытались предоставить точную информацию о лицензировании для вышеуказанных зависимостей для удобства наших пользователей. Эта информация ни в коем случае не является окончательной и может содержать ошибки. Любые вопросы о лицензиях или законности использования этих пакетов программного обеспечения следует направлять авторам программного обеспечения. Не полагайтесь исключительно на информацию о лицензии, представленную выше!

Ярлыки в этом документе

Для простоты этого документа мы предполагаем, что вы загрузили Primer Prospector в / home / pprospector /.Вы должны рассматривать все вхождения / home / pprospector / в оставшейся части этого документа как ссылки на каталог, содержащий каталог Primer Prospector, который у вас будет после загрузки и распаковки Primer Prospector.

Стабильная версия

В настоящее время самой стабильной версией Primer Prospector является наша версия 1.0.1, которую вы можете скачать здесь.

Последняя версия разработки

Чтобы получить последнюю разрабатываемую версию Primer Prospector, вы получаете доступ к нашему репозиторию Sourceforge.Несмотря на то, что в этот код могут быть внесены незначительные изменения в интерфейсе, он предоставит доступ к новейшим и наиболее значительным функциям. Официальная веб-документация, скорее всего, устарела в отношении программного обеспечения для разработки. Вместо этого вам следует обратиться к документации svn в pprospector / doc. Проверьте последнюю версию Primer Prospector, используя svn с командой:

 svn co https://pprospector.svn.sourceforge.net/svnroot/pprospector/trunk pprospector 
Пользователи

svn должны периодически обновлять Primer Prospector, используя следующую команду:

Обновление svn
 / главная / pprospector / 

Распаковка Primer Prospector (только выпуск)

После загрузки tar-файла с выпуском Primer Prospector вам нужно будет распаковать код.Для простоты в этом документе мы предполагаем, что вы загрузили Primer Prospector в каталог / home / pprospector /.

Распакуйте tar-файл релиза Primer Prospector с помощью команд:

 cd / home / pprospector
tar -xvzf pprospector-1.0.1.tar.gz 

Если вы скачали из svn, Primer Prospector уже распакован.

Установка Primer Prospector

Primer Prospector состоит из кода библиотеки (в pprospector / primerprospector), тестового кода (в pprospector / tests), документации (в pprospector / doc) и скриптов (в pprospector / scripts).Установка Primer Prospector состоит из запуска тестов (необязательно, но настоятельно рекомендуется), установки кода библиотеки в место, где python знает, где его найти, и установки скриптов в место, где оболочка ищет исполняемые файлы.

Установка кода библиотеки и скриптов с помощью setup.py

Использование pprospector / setup.py (и, следовательно, пакета distutils python) является рекомендуемым способом установки кода и скриптов библиотеки Primer Prospector. При желании вы можете указать, где должны быть установлены код библиотеки и сценарии - в зависимости от ваших настроек вы можете захотеть это сделать.По умолчанию код библиотеки Primer Prospector будет помещен в пакеты сайтов python, а скрипты Primer Prospector будут размещены в / usr / local / bin /. Вам может потребоваться запустить setup.py с помощью sudo, если у вас нет разрешения на размещение файлов в местах по умолчанию.

Во-первых, убедитесь, что вы находитесь в каталоге QIIME верхнего уровня:

По умолчанию скрипты Primer Prospector устанавливаются в / usr / local / bin. Поскольку существует множество сценариев Primer Prospector, мы рекомендуем настроить каталог сценариев, чтобы ваша система оставалась организованной.Это можно настроить с помощью параметра --install_scripts:

 python setup.py install --install-scripts = / home / pprospector / bin / 

Аналогичным образом можно установить код библиотеки в другое место, используя параметр --install-purelib:

 python setup.py установить --install-purelib = / home / pprospector / lib / 

Объедините эти варианты следующим образом:

 python setup.py install --install-scripts = / home / pprospector / bin / --install-purelib = / home / pprospector / lib / 

Для полного обсуждения настроек, связанных с установкой.py скрипт, см. эту страницу.

Если вы использовали значения по умолчанию для --install-scripts и --install-purelib (не указывая их), ваша установка должна быть завершена. Если вы указали альтернативное значение для --install-scripts, вам необходимо убедиться, что оболочка знает, где искать скрипты. Если вы используете оболочку bash и местоположения, указанные в примерах выше, вы можете сделать это с помощью следующей команды:

 echo "экспорт ПУТЬ = / home / pprospector / bin /: $ PATH" >> / home / pprospector /.bashrc 

Если вы указали альтернативное значение для --install-purelib, вы должны быть уверены, что python знает, где искать Primer Prospector. Если вы используете оболочку bash и местоположения, указанные в примерах выше, вы можете сделать это с помощью следующей команды:

 echo "экспорт PYTHONPATH = / home / pprospector / lib /: $ PYTHONPATH" >> /home/pprospector/.bashrc 

Исходный код вашего .bashrc:

 источник /home/prospector/.bashrc 

Запуск набора тестов

Далее следует запустить набор тестов.Выполните следующие команды:

 cd / home / pprospector / tests /
Python all_tests.py 

Вы увидите тестовый вывод на терминале, указывающий на успешное и неудачное выполнение теста. Некоторые неудачи - это нормально. Команда all_tests.py завершит сводку ошибок теста. Некоторые тесты могут завершиться ошибкой из-за отсутствия внешних приложений - они будут отмечены отдельно от других тестов. Если они связаны с функциями Primer Prospector, которые вы не используете, это приемлемо. В противном случае вам нужно будет убедиться, что у вас правильно установлены внешние приложения (и правильные версии), и повторно запустить тесты.

Тестирование установки Primer Prospector

Если Primer Prospector установлен правильно, вы сможете запускать скрипты Primer Prospector. Попробуйте следующее:

Это должно дать вам текст справки, описывающий интерфейс для скрипта analysis_primers.py. (Обратите внимание, что если у вас нет /home/pprospector/.bashrc, вы можете получить ошибку на исходном этапе. Если вы не указали альтернативные значения для --install-purelib или --install-scripts, это не должно быть проблема.)

Замечания по установке внешнего приложения

Переменная среды PATH

Внешние приложения, используемые Primer Prospector, должны быть видимы оболочке, поскольку они должны существовать в исполняемом пути поиска (то есть перечисляться в переменной среды $ PATH). Например, если вы планируете использовать классификатор RDP и у вас установлены исполняемые файлы классификатора RDP в / home / pprospector / bin, вы можете добавить этот каталог в свой системный путь с помощью команд:

 echo "экспорт ПУТЬ = / home / pprospector / bin /: $ PATH" >> / home / pprospector /.bashrc
источник /home/pprospector/.bashrc 

Переменная среды PYTHONPATH

Primer Prospector, PyCogent, Matplotlib и NumPy должны быть видимы для python для всех функций Primer Prospector. Если вы использовали их, вам не нужно изменять PYTHONPATH, чтобы сделать код библиотеки видимым. Если вы не использовали соответствующие сценарии setup.py или указали альтернативное значение для --install-purelib, вам может потребоваться добавить расположение этих библиотек в переменную среды PYTHONPATH.

Например, если вы установили RDP в / home / pprospector / RDP, вы можете добавить его в свой PYTHONPATH с помощью команд:

 echo "экспорт PYTHONPATH = / home / pprospector / RDP /: $ PYTHONPATH" >> /home/pprospector/.bashrc
источник /home/pprospector/.bashrc 

RDP_JAR_PATH Переменная среды

Если вы планируете использовать классификатор RDP для отчетов об оценке таксономии, вы также должны определить переменную RDP_JAR_PATH. Если у вас есть jar-файл классификатора RDP (rdp_classifier-2.0.1.jar) в / home / rdp / app, вы можете сделать это с помощью следующей команды:

 echo "экспорт RDP_JAR_PATH = / home / rdp / app / rdp_classifier-2.0.1.jar" >> /home/rdp/.bashrc
источник /home/rdp/.bashrc 

Building The Primer Prospector Documentation

Если вы используете svn-версию Primer Prospector, вы можете создать документацию локально для доступа к последней версии. Вы можете перейти в каталог pprospector / doc и запустить (вам может потребоваться перед командой sudo ):

Мы пытаемся обновлять документацию по мере обновления кода, но пользователи svn могут заметить некоторые неточности.После создания документации вы можете просмотреть ее в веб-браузере, открыв файл pprospector / doc / _build / html / index.html. Вы можете добавить эту страницу в закладки для облегчения доступа.

% PDF-1.7 % 139 0 объект > эндобдж 108 0 объект > поток 2021-08-30T01: 59: 20-07: 002019-11-12T14: 44: 41 + 01: 002021-08-30T01: 59: 20-07: 00application / pdfuuid: 0d9478fe-07f0-4141-b1f0-9f9cf9f83075uuid: c7f40684-1dd1-11b2-0a00-8800a8f79dff конечный поток эндобдж 137 0 объект > эндобдж 9 0 объект > эндобдж 19 0 объект > эндобдж 38 0 объект > эндобдж 36 0 объект > / MediaBox [0 0 595.2 841.92] / Parent 38 0 R / Resources> / Font> / ProcSet [/ PDF / Text] >> / Rotate 0 / StructParents 14 / Tabs / S / TrimBox [0 0 595.2 841.92] / Type / Page >> эндобдж 39 0 объект > / MediaBox [0 0 595.2 841.92] / Parent 38 0 R / Resources> / Font> / ProcSet [/ PDF / Text / ImageC] / XObject >>> / Rotate 0 / StructParents 1 / Tabs / S / TrimBox [0 0 595.2 841.92] / Тип / Страница >> эндобдж 50 0 объект > / MediaBox [0 0 595.2 841.92] / Parent 38 0 R / Resources> / Font> / ProcSet [/ PDF / Text] >> / Rotate 0 / StructParents 15 / Tabs / S / TrimBox [0 0 595.2 841.92] / Тип / Страница >> эндобдж 52 0 объект > / MediaBox [0 0 595.2 841.92] / Parent 38 0 R / Resources> / Font> / ProcSet [/ PDF / Text] >> / Rotate 0 / StructParents 16 / Tabs / S / TrimBox [0 0 595.2 841.92] / Type / Страница >> эндобдж 54 0 объект > / MediaBox [0 0 595.2 841.92] / Parent 38 0 R / Resources> / Font> / ProcSet [/ PDF / Text / ImageC] / XObject >>> / Rotate 0 / StructParents 2 / Tabs / S / TrimBox [0 0 595.2 841.92] / Тип / Страница >> эндобдж 60 0 объект > / MediaBox [0 0 595.2 841.92] / Parent 38 0 R / Resources> / Font> / ProcSet [/ PDF / Text / ImageC] / XObject >>> / Rotate 0 / StructParents 17 / Tabs / S / TrimBox [0 0 595.2 841.92] / Тип / Страница >> эндобдж 64 0 объект > / MediaBox [0 0 595.2 841.92] / Parent 38 0 R / Resources> / Font> / ProcSet [/ PDF / Text] >> / Rotate 0 / StructParents 18 / Tabs / S / TrimBox [0 0 595.2 841.92] / Type / Страница >> эндобдж 66 0 объект > / MediaBox [0 0 595.2 841.92] / Parent 38 0 R / Resources> / Font> / ProcSet [/ PDF / Text / ImageC] / XObject >>> / Rotate 0 / StructParents 3 / Tabs / S / TrimBox [0 0 595.2 841.92] / Тип / Страница >> эндобдж 74 0 объект > / MediaBox [0 0 595.2 841.92] / Parent 38 0 R / Resources> / Font> / ProcSet [/ PDF / Text / ImageC] / XObject >>> / Rotate 0 / StructParents 4 / Tabs / S / TrimBox [0 0 595.2 841.92] / Тип / Страница >> эндобдж 79 0 объект > / MediaBox [0 0 595.2 841.92] / Parent 38 0 R / Resources> / Font> / ProcSet [/ PDF / Text] >> / Rotate 0 / StructParents 19 / Tabs / S / TrimBox [0 0 595.2 841.92] / Type / Страница >> эндобдж 81 0 объект > / MediaBox [0 0 595.2 841.92] / Parent 38 0 R / Resources> / Font> / ProcSet [/ PDF / Text] >> / Rotate 0 / StructParents 20 / Tabs / S / TrimBox [0 0 595.2 841.92] / Type / Страница >> эндобдж 83 0 объект > / MediaBox [0 0 595.2 841.92] / Parent 38 0 R / Resources> / Font> / ProcSet [/ PDF / Text] >> / Rotate 0 / StructParents 21 / Tabs / S / TrimBox [0 0 595.2 841.92] / Тип / Страница >> эндобдж 85 0 объект > / MediaBox [0 0 595.2 841.92] / Parent 38 0 R / Resources> / Font> / ProcSet [/ PDF / Text] >> / Rotate 0 / StructParents 22 / Tabs / S / TrimBox [0 0 595.2 841.92] / Type / Страница >> эндобдж 87 0 объект > / MediaBox [0 0 595.2 841.92] / Parent 38 0 R / Resources> / Font> / ProcSet [/ PDF / Text] >> / Rotate 0 / StructParents 23 / Tabs / S / TrimBox [0 0 595.2 841.92] / Type / Страница >> эндобдж 89 0 объект > / MediaBox [0 0 595.2 841.92] / Parent 38 0 R / Resources> / Font> / ProcSet [/ PDF / Text] >> / Rotate 0 / StructParents 24 / Tabs / S / TrimBox [0 0 595.2 841.92] / Тип / Страница >> эндобдж 91 0 объект > / MediaBox [0 0 595.2 841.92] / Parent 38 0 R / Resources> / Font> / ProcSet [/ PDF / Text] >> / Rotate 0 / StructParents 25 / Tabs / S / TrimBox [0 0 595.2 841.92] / Type / Страница >> эндобдж 96 0 объект > / MediaBox [0 0 595.2 841.92] / Parent 38 0 R / Resources> / Font> / ProcSet [/ PDF / Text] >> / Rotate 0 / StructParents 26 / Tabs / S / TrimBox [0 0 595.2 841.92] / Type / Страница >> эндобдж 98 0 объект > / MediaBox [0 0 595.2 841.92] / Parent 38 0 R / Resources> / Font> / ProcSet [/ PDF / Text] >> / Rotate 0 / StructParents 27 / Tabs / S / TrimBox [0 0 595.2 841.92] / Тип / Страница >> эндобдж 100 0 объект > / MediaBox [0 0 595.2 841.92] / Parent 38 0 R / Resources> / Font> / ProcSet [/ PDF / Text] >> / Rotate 0 / StructParents 28 / Tabs / S / TrimBox [0 0 595.2 841.92] / Type / Страница >> эндобдж 102 0 объект > / MediaBox [0 0 595.2 841.92] / Parent 38 0 R / Resources> / Font> / ProcSet [/ PDF / Text] >> / Rotate 0 / StructParents 29 / Tabs / S / TrimBox [0 0 595.2 841.92] / Type / Страница >> эндобдж 212 0 объект [215 0 R 216 0 R] эндобдж 213 0 объект > поток HWYsF ~ ׯ #% 1. W * U'u "fw

03) ~ i6G} 7y7Earw2dVlm? 8N> $,?% QZLD䷿E ۓ UN & iqM? Bh: R.YZˢd $ x ߓ / ϓMb ¢ BE`vldru7jmWh * = G \ 8O7? Cy4cFm, xq + zo, Σ & ECҜ ~, cXp} 'bH | _y = ܄5> ipl 5.j} ̦ _! - ޠ Ќ ~ A̬ {cQ9ļF; uQ ~ fUU & X {_BI1 쪊 VQjo} wDˏ1Ll # & ի ıc ՙ `Ngh

Майнеры принимают вызов 17-го ранга Jayhawks - Prospector

Шахтеры UTEP играют на выезде на 17-м -м ​​месте Канзас-Джейхокс 18:00. сыграть в первую историческую игру команды в истории школы в Лоуренсе, штат Канзас.

Лишь четыре раза в истории две команды пересекались, и «горняки» держали прижизненный рекорд 3: 1 против Канзаса.Две команды последний раз играли в 2013 году на Багамах, где Канзас одержал победу с небольшим счётом 67-63. Канзас - также последняя команда, которую UTEP обыграл в турнире NCAA в 1996 году.

Kansas - самая известная команда, с которой UTEP столкнулась в этом сезоне, и третья команда Power Five, с которой команда играла в этом сезоне. Ранее UTEP обыграл штат Аризона в декабре и одержал первую победу в Power Five с 2013 года. В целом, UTEp одержал две победы в Power Five за последние 20 лет. Штат Аризона вошел в топ-25 предсезонных рейтингов, но не оправдал ожиданий.

Обладая вторым рекордом на конференциях в Большой 12, Канзас зарекомендовал себя как команда высшего уровня в Большой 12, в то время как UTEP, в лучшем случае, была средней командой в Conference-USA. Канзас одерживает впечатляющую победу над занявшим второе место Бэйлором 71-58. В обороне Канзас был подавлен в этом матче, поскольку «Джейхокс» удерживали Бэйлора до минимального в сезоне общего количества очков.

UTEP выиграл четыре игры подряд и очень впечатляюще сыграл в защите против Шарлотты, одержав две двузначные победы в минувшие выходные.В нападении «горняки» смогли забить 10 из 20 3-х очков в предыдущем матче команды.

В целом обе команды набирают чуть больше 70 очков за игру. В Канзасе оппоненты набирали 66 очков за игру, а UTEP - 68 очков. У Канзаса более стабильный процент стрельбы - 44%, в то время как UTEp стреляет около 43%. Jayhawks также немного лучше стреляют из 3-х очков (34%) по сравнению с 33% UTEP.

Как устроена команда:

Размер: вся стартовая пятерка для Канзаса - 6-5 или выше, и это очень сложный состав защитников.В целом самых высоких игроков в Канзасе всего 6–10, так что «Джейхоки» не будут возвышаться над «горняками», но когда самому маленькому игроку в команде 6–5, возникают проблемы с матчем.

Стартовая пятерка. Канзас - одна из самых сбалансированных команд в стране, и каждая из них в среднем набирает более 10 очков за игру. UTEP в значительной степени зависит от очков юниора Сули Баума и старшего Брайсона Уильямса. Все остальные голы зависят от игры к игре, хотя у юниора Кеонтая Кеннеди наблюдаются проблески. Обе команды играют в стартовом составе много минут, поэтому не допускать проблем с фолами - главный ключ для «горняков».У Канзаса один из лучших защитников в стране в составе со старшим Маркусом Гарретом. Гаррет получил награду «Нейсмит» как лучший защитник страны в прошлом сезоне и может закрывать лучших бомбардиров, а также быть полевым генералом «Джейхок».

Глубина скамьи:

Хотя ни одна из команд много не использует скамейку запасных, «Джейхокс» заметили дополнительную продуктивность от одного из лучших новичков страны, Брайса Томпсона. В 6-5 Томпсон - еще один спортивный защитник, которого можно бросить в «горняков».Для младшего защитника «горняков» Кристиан Агнью стал искрой со скамейки запасных, которая так была нужна в последние недели. Джуниор Эфе Одиджи наконец-то смог сыграть после месяца отсутствия в протоколе сотрясения мозга и заявил о своем влиянии солидным уик-эндом, сыграв наибольшее количество минут в этом сезоне. Агнью, вероятно, получит больше шансов против «Канзаса» из-за тяжелого нападения команды.

Ключи к победе

Он просто делает то, что у вас получается лучше всего, разбрасывает мяч, наносит открытые удары и хорошо защищает Канзас.UTEP придется улучшить движение мяча и искать свободные удары. Если UTEP сможет поразить 45% своих бросков и избежать проблем с фолом, у Канзаса может быть гораздо более тяжелая ночь, чем предполагалось. За последние два сезона UTEP играл на уровне соперника выше или ниже, но когда его мотивировали в обороне, «горняки» создавали проблемы для хороших команд. Прежде всего, у «горняков» не должно быть проблем с фолами, и особенно из-за того, что Уильямс не должен сидеть значительные минуты из-за этой проблемы. «Горнякам» также придется искать других игроков, которые забьют, потому что это всего лишь шоу Уильямса Боума; Джейхоки проведут гораздо более комфортную ночь в обороне.

Прогноз:

Хотя. У UTEP есть талант в стартовом составе, чтобы дать Канзасу игру; химия в целом, кажется, не там, где должна быть в этот момент сезона. Я вижу, что UTEP теряет скорость из-за этих факторов и проигрывает 78-63.

Игра транслируется на ESPN + и транслируется на ESPN Radio AM 600.

С Майклом Кувьелло можно связаться по телефону

[электронная почта]

пар праймеров EST, выбранных GeM prospector. Обратите внимание, что праймеры сайлен-эст были модифицированы из этих

90ACCAT 90ACCAT 90ACCAT m02492 экспрессированный белок m01915 экзонуклеаза белок семейства содержит экзонуклеазную домен, Pfam: PF00929 EST25 = U1Gem24 82
EST01 = S1Gem3 At2g21170.1 TATGCTYTGASCGARGGTCTTGGAG AATGAAGCACCWCCRACAAGAAATCCATC 120 68415.m02511 триозофосфатизомераза, хлоропласт, предполагаемый похож на триозофосфатизомераза, хлоропласт предшественника: ИП | P48496 из Spinacia Oleracea, ИП | P46225 из Secale Cereale
EST02 = S1Gem4 At5g12310.1 GCYCTTGTWAAAGGTTGCGAGCATGCT AYTCAAATGGATKTTTRCACTGRGG 61 68418.m01447 цинковый палец (C3HC4-тип, тип RING4 пальца) 68418.m01447 цинковый палец (C3HC4-тип, тип PING4 пальца, RING) 90C4 палец, тип 907C4, тип RING4, содержит 909C палец, профиль RING4 * At2g26590.1 CTGSAGTTYCGTGCTGGYAAAATGT TCCTGCAWCCAGAARAAGAACT 54 68415.m03190 Семейство молекул, регулирующих адгезию, подобных белку мембраны ооцита (GI: 6174842) [Xen]; аналогичен предшественнику регулирующей адгезию молекулы 1 (гликопротеин клеточной мембраны 110 кДа) (Gp110) (Swiss-Prot: Q16186) [Homo sapiens]; содержит Pfam PF04683: консервативная область молекулы, регулирующей адгезию
EST04 = S1Gem7 At3g17810.1 GCTGCTGTTGGRCARGATTGTG TCAGCAGCATGTCTGTG TCAGCAGCATGTC6690 TCAGCAGCATGTC690m02271 белок семейства дигидрооротатдегидрогеназы / белок семейства дигидрооротатоксидазы низкое сходство с SP | Q12882 Предшественник дигидропиримидиндегидрогеназы [НАДФ +] (EC 1.3.1.2) (DPD) (DHPDHase) (дигидроурацилдегидрогеназа) (дигидротимин} дегидрогеназа) содержит профиль Pfam PF01180: дигидрооротатдегидрогеназа
EST05 = S1Gem8 At4g16450.1 CCGGCRTTTCCGTYACCGTCGG TTCTGRTAAGCR6CCATGA TTCTGRTAAGCR6CCATGA
EST06 = S1Gem10 * At1g10740.1 TGCCTMTTGGGGAATGCAGGYCCATTTGC TWGTGTTKAGTGCTCCATCATTG 64 68414.m01225 экспрессированный белок
EST07 = S1Gem14 * At3g02780.1 CAYAGAGCTTTYAGTGTRTTYCTGTT TGCTCTCCCCATTTSCCATC 57 68416.m00270 изопентенилдифосфат дельта-изомераза II / изопентенилдифосфат: диметилаллилдифосфат-изомераза II (IPP2), идентичная изопентенилдифосфат-изомеразе II (IPP2); = S1Gem15 * At3g04870.1 GATCCWGTTGCYTATGCCCTTGGG TCTGTAACCCAWCCATTGTATCTGAGTTGCAC 147 68416.m00528 дзета-каротин-десатураза (ZDS1) / десатураза каротина 1.1, идентичная предшественнику каротина, хлоро-каротина 7,88 , 8-десатураза) {Arabidopsis thaliana} At3g04870.2 68416.m00529 дзета-каротин-десатураза (ZDS1) / 7,8-десатураза каротина, идентичная SP | Q38893 Зета-каротин-десатураза, предшественник хлоропласта (EC 1.14.99.30) (Каротин 7,8 , 8-десатураза) {Arabidopsis thaliana}
EST09 = S1Gem16 * At3g06580.1 GCTGCKCAYGTGTATTCWGAAGCCA AGCWGCACCACTYGAWGGCTTGGAAGCA 124 68416.m00764 galactokinase (GAL1) идентичен galactokinase (галактоза киназа) [Резуховидка Таля] Swiss-Prot: Q9SEE5
EST10 = S1Gem17 * At3g06650.1 GGAATGTTCACMAARCAAGAGATTG AGWACRTCYTCCCATGGGTGRCGGT 90 68416.m00774 АТФ-цитратсинтаза, предположительно / АТФ-цитрат (про-S -) - лиаза, предполагаемый фермент / цитратное расщепление, аналогичное цитратному расщеплению GGA : 13160653; содержит профили Pfam PF00549: CoA-лигаза, PF02629: CoA-связывающий домен
EST11 = S1Gem19 * At3g55280.1 CTGAGTCSGCAATGAAGAARATTGARGACAACAAC CCAATCTTGTTDGCHACATCCA 62 68416.m06139 60S рибосомных белков L23A (RPL23aB) различные белки рибосомальной L23a
EST12 = S1Gem20 At4g25550.1 GATCGTCTYGCTCGYATGARAGTCA CACTCCTTSGGTTTTGTTATRTGAGGAGGGCAG 137 68417 .m03683 экспрессированный белок
EST13 = S1Gem27 * At3g15140.1 CCTCAAGAAATAATYGAGTTYCCRTCTGT TCRAGCCATTTGTCATGC 68 83
EST14 = S1Gem28 At3g58610.1 GAGGHATYTTACTTGGKGCTGTTCA CAGTTRTCAACCATGAARGARACACCRCG 51 68416.m06532 кетол-кислотных reductoisomerase идентичен кетол-кислоту reductoisomerase, предшественник хлоропласта (EC 1.1.1.86) (Ацетогидроксикислотредуктоизомераза) (Альфа-кето-бета-гидроксилацилредуктоизомераза) (Swiss-Prot: Q05758) [Arabidopsis thaliana]
EST15 = S1Gem29 70 * At5g1160 * At5g115.1 ACCAAYAAGATGGCYCCYGCTCTTC TGGTAGTATCCYCCWCCRTTAGCAC 96 68418.m01374 НАДН-убихинон оксидоредуктаза из 20-кДа-субъединицы кДа-фрагмента арабинон-оксидоредуктазы из арабской субединицы NADHD77 [субчастица NADHD77, идентичная субъединице кДа-фрагмента арабин, 20 кДа, митохондриальная субчастица NADHD77, [митохондриальная субчастица NADHD77] содержит профиль Pfam: PF01058 NADH убихинон оксидоредуктаза, субъединица 20 кД
EST16 = S1Gem31 * At5g24490.1 CWGATCATGGTC661 CWGATCATGTGTC661 CWGATCATGTGTC661 CWGATCATGTGTC661CAYATGAARGG 906GRAm02886 30S рибосомный белок, предположительно похожий на SP | P19954 Пластид-специфический 30S рибосомный белок 1, предшественник хлоропластов (CS-S5) (CS5) (S22) (рибосомный белок 1) (PSRP-1) {Spinacia oleracea}; содержит Pfam профиль PF02482: Сигма белок 54 модуляции / S30EA рибосомных белков
EST17 = S1Gem32 At5g38900.1 TGYCCATGGTGCTTTGTTGG TTCYTCRACWAGATCATGTTGCTTRTCA 71 68418.m04705 DsbA оксидоредуктазы белок семейства содержит профиль Pfam: PF01323 DSBA- как домен тиоредоксина
EST18 = S2Gem19 At1g02140.1 AAYAAYTCCAAYTACAAAAACGAYAC TCCTGAACAAGATAGTARAARATGCGAAG 10 68414.m00140 белок семейства mago nashi, аналогичный Mago Nashi, регистрационный номер Genbank U03559; содержит Pfam PF02792: домен белка Mago nashi
EST19 = S2Gem25 At3g05000.1 GGWTATCARGTCGGTCAHCARCTCTC GCAGAMACTGCACADGAG43, транспортный белок для частиц 33, семейство транспортных частиц. субъединица кДа (субъединица 33 кДа TRAPP) (Swiss-Prot: Q99394) [Saccharomyces cerevisiae]; содержит профиль Pfam PF04051: компонент частиц транспортного белка (TRAPP), Bet3
EST20 = S2Gem36 * At5g50375.1 ATGTAYAAAGTTGGATSHTTGTTTTAYGC ATGCGCCACAAATCWAGTATTATTGTSACYAGC 47 68418.m06239 циклопропил изомеразы (индекс потребительских цен1)
EST21 = U1Gem5 At5g12310.1 CAGGARACTGCYCTTGTWAAAGGTTGCGAGCATGC AYTCAAATGGATKTTTRCACTGRGG 70 68418.m01447 цинковый палец (C3HC4 -типа RING finger) белок семейства содержит профиль Pfam: цинковый палец PF00097, тип C3HC4 (RING finger)
EST22 = U1Gem6 * At5g13720.1 ATTTTYGACTTYCGTTTCTTGGC GTCCAATARACTTTGTATGCWTCAA 9 68418.m01597 экспрессированный белок
EST23 = U1Gem9 At3g42050.1 CAGCTYCTTTATGARACATGTCTCTG TCATGATTCATTAGTTTCATCACCCGTTCCTTGGC 113 68416.m04311 вакуольная АТФ-синтазы субъединица Н белок семейства идентична вероятной субъединице H вакуолярной АТФ-синтазы (EC 3.6.3.14) (субъединица V-АТФазы H) (субъединица H вакуумного протонного насоса) (субъединица SFD вакуумного протонного насоса) SP: Q9LX65 из [Arabidopsis thaliana]; содержит Pfam PF03224: субъединица V-АТФазы H
EST24 = U1Gem13 * At4g37830.1 AAATGGGAGAAGATHACMTAYCTAGG GGGAATTCCTTRTTGCGRATRTGCA 63 68417.m05352, родственный цитохрому с оксидазой, имеет слабое сходство с цитохром-с-оксидазой: 1,9-предшественник цитохрома с, полипептид норд-с-оксидазы 1,9 (швейцарский полипептид норд-с-оксидазы). ]
+
* At3g06580.1 CATCAGAGAGCTGCKCAYGTGTATTCWGAAGCC AGCWGCACCACTYGAWGGCTTGGAAGCA 145 68416.m00764 galactokinase (GAL1) идентичен galactokinase (галактоза киназа) [Резуховидка Таля] Swiss-Prot: Q9SEE5
EST26 = U1Gem26 * At4g26550.1 GACACCGTTTCSGGYACTTTC ACCATGACAGGMAGGAACA 93 68417.m03824 экспрессированный белок вероятным мембранный белок YBL102w, дрожжи, PIR2: S45393
EST27 = U1Gem39 At3g52940.1 TYGCTAGACRCTGTMATTACYTAGG ACATAAGGYAAWATTCTCCAWGGAAC 47 68416.m05835 C-14 стеролредуктаза / дельта (14) -стеролредуктаза / FACKEL (FK) идентично gi:
EST28 = U1Gem40 At3g58610.1 TTACTTGGKGCTGTTCATGG CAGTTRTCAACCATGAARGARACACCRCG 63 68416.m06532 кетол-кислотная редуктоизомераза, идентичная кетол-кислотной редуктоизомеразе, кетол-кислотной редуктоизомеразе, кето-кислотно-редуктоизомеразе (A-редуктозомераза), альфа-кислот-редукто-гидрокси-редуктоза (А) -редукто-гидрокси-альфа-1,1-альфа-1-предшественник (EC). (Swiss-Prot: Q05758) [Arabidopsis thaliana]
EST29 = U1Gem41 At5g38900.1 TGYCCRTGGTGCTTTGTTGGMAAAA TTCYTCATTRGACWAGm04705 DsbA оксидоредуктазы белок семейство содержит профиль Pfam: PF01323 DsbA-подобный домену тиоредоксина
EST30 = U1Gem42 * At5g50375.1 ATGTAYAAAGTTGGATSHTTGTTTTAYGC ATGCGCCACAAATCWAGTATTATTGTGACYAGC 58 68418.m06239 циклопропильных изомераз (индекс потребительских цен1)
EST31 = U2Gem11 * At2g26590.1 CTGSAGTTYCGTGCTGGYAAAATGT GRTTCCTGCAWCCAGAARAAKAACT 15 68415.семейство молекул, регулирующих адгезию, m03190, подобных белку мембраны ооцита (GI: 6174842) [Xenopus laevis]; аналогичен предшественнику регулирующей адгезию молекулы 1 (гликопротеин клеточной мембраны 110 кДа) (Gp110) (Swiss-Prot: Q16186) [Homo sapiens]; содержит Pfam PF04683: Адгезия регулирующие молекулы консервативную область
EST32 = U2Gem17 * At1g71270.1 CWGTWTTTGCWCTTGGGGATAGRAT AGCAGCTTSTGCAAGCTCC 66 68414.m08225 Vps52 / Sac2 белок семейства похож на SP | P39904 SAC2 белок {Saccharomyces cerevisiae}; содержит профиль Pfam PF04129: семейство Vps52 / Sac2
EST33 = U2Gem36 * At3g45300.1 CTWGTSTTTGAGAATTGCTTYGTKCC ATAAACTGAAAYTCYCCAATMGGACG 51 68416.m04891 изовалерил-КоА-дегидрогеназа (IVD) идентична изовалерил-СоА-дегидрогеназы предшественника [Резуховидка Таля] GI: 5596622
EST34 = U2Gem42 * At5g47570. 1 GGCGGAAACGGCGTCGTT CARATTGTCATATGGATABACYTTSGG 51 68418.m05872 экспрессированный белок

Рекомендации - Макияж для выпускного - The Prospector Некоторые из лучших выпускных вечеров

.Но, будучи студентом, может быть трудно выглядеть наилучшим образом с ограниченным количеством времени. Не волнуйтесь, вот список лучших косметических продуктов, которые мы рекомендуем, которые гарантированно заставят вас сиять.

Грунтовка: bareMinerals Prime Time Foundation Primer

Этот праймер - идеальный выбор для тех, кто борется с жирной или сухой кожей! Ему удается контролировать маслянистость, одновременно гарантируя, что любые сухие участки не будут подчеркнуты тональным кремом. Он скрывает поры и текстуру и делает вашу кожу очень мягкой и гладкой.Благодаря этому праймеру любой макияж, который вы наносите поверх, будет очень хорошо носить, так что вы можете провести всю ночь, танцуя и весело проводя время, не беспокоясь о том, что ваш макияж размазывается! Обязательно нанесите это пальцами на Т-зону и хорошо втирайте!

Основа: Maybelline Fit Me Matte + Poreless

Одна из лучших основ, которые я когда-либо пробовал, - это Maybelline Fit Me Matte + Poreless. Вы можете найти его в любой аптеке, он действительно недорогой и представлен более чем 40 оттенками.Этот тональный крем также имеет более естественный вид (он называется Maybelline Fit Me Dewy + Smooth), но Matte + Poreless подходит как для сухой, так и для жирной кожи. Он не совсем матовый, чтобы не указывать на то, где ваше лицо кажется безразмерным. Эта тональная основа прекрасно ложится на кожу и выглядит так, будто на вас вообще нет макияжа. В довершение ко всему, он очень долговечный, а это значит, что он прослужит всю ночь! Этот тональный крем легко наносится губкой или кистью для тонального крема.Просто убедитесь, что вы нашли время, чтобы смешать его, чтобы не выглядеть полосатым!

Консилер: L.A. Girl Pro Concealer

Этот консилер просто потрясающий. Покрытию удается скрыть темные участки или высыпания, при этом не слеживаясь. Кроме того, он идеально подходит для кремового контура, так что вы можете еще больше вылепить лицо, прежде чем наносить контур пудры. Он также доступен по цене - всего пять долларов. Он бывает самых разных оттенков и даже может корректировать цвет. Он кремовый, легкий и может скрыть все, что вы хотите скрыть!

Пудра: Makeup Revolution Luxury Banana Baking Powder

Хотя эта пудра рекламируется как разрыхлитель, она идеально подходит для всего лица.Эта пудра прекрасно укладывает любую основу и лучше всего подходит для закрепления консилера. Поскольку это рассыпчатый порошок, он может немного испачкаться, если вы не будете осторожны. При правильном использовании он тает на вашей коже и сохраняет основу навсегда. Поскольку это банановая пудра, это не заставит вас вспомнить фотографии и не изменит цвет основы или консилера.

Bronzer: преимущество Hoola Bronzer

Идеально подходит как для придания коже загара, так и для коррекции контуров скул.Несмотря на то, что это матовый бронзер, он возвращает коже жизнь и цвет, не делая ваше лицо слишком плоским. Он идеально подходит для множества оттенков кожи, и если вы придерживаетесь более светлой стороны, Benefit недавно выпустила «Hoola Lite», который по сути является тем же оттенком бронзатора, но более светлого оттенка.

Хайлайтер: Becca Shimmering Skin Perfectors

Из всех хайлайтеров, которые я когда-либо пробовал (и поверьте мне, их было МНОГО), это один из немногих, которым удается придать вам истинное сияние изнутри.Его легко создать от легкого блеска до полного свечения, и в нем нет массивного блеска или мерцания. Он очень тонкий и не подчеркивает поры или текстуру, которые у вас могут быть.

Палетка теней для век: Anastasia Beverly Hills Modern Renaissance Eyeshadow Palette

Несмотря на то, что эта палитра стоит 42 доллара, она идеально подходит для создания множества разных образов глаз. Если вы хотите чего-то более золотистого или розового, эта палитра идеально подходит для вас! Он идеально сбалансирован с множеством матовых и мерцающих теней для век, которые действительно пигментированы и легко растушевываются.Они идеально подходят для всех, кто новичок в макияже, потому что тени для век действительно просты в использовании. Матовые тени практически не требуют растушевки, а мерцающие тени привлекают внимание и не потускнеют в течение ночи!

Тушь: L’oreal Lash Paradise

Эта тушь для ресниц хорошо известна тем, что подделка туши более высокого класса, и она удивительно удлиняет ваши ресницы и придает им объем, не делая их слишком комковатыми!

Primer | Блог - Майя Дэвис, художник и предприниматель

Я позвонил Майе Дэвис в начале июня 2020 года, когда волна протестов Black Lives Matter прокатилась по всему миру как прямой ответ на жестокость полиции и системный расизм против чернокожих американцев.Он поприветствовал меня хрипло. «О Боже, мой голос пропал», - усмехнулся он. «Видишь ли, я был вчера на своих местных протестах. Это было действительно хорошо, и я только что узнал, что у моей семьи есть мегафон, поэтому я определенно беру его ».

Мья имел в виду мирные протесты в Санта-Кларите, тихом пригороде Южной Калифорнии, где он проводил лето в доме своего детства. Между прочим, он ответил на мой звонок из комнаты, где его мама обучала его и его сестру на дому, когда они были детьми.Он устроил мне экскурсию, осторожно покрутив компьютер - напротив него шкафы провисали под стопками книг, бумаг и прошлых проектов. Выключенный телевизор спрятался в закрытом шкафу, где Миа выросла, наблюдая за Симпсонами и играя в Just Dance. Все окружали оранжевые стены, увешанные афишами фильмов о Черной пантере, Лиге справедливости и Чудо-женщине.

Мя снова поставил ноутбук прямо на колени и откинулся назад, осматривая пространство. «Да, вау», - медленно сказал он. «Это… одна комната.В последний раз я воспринимал это как комнату для домашнего обучения пять лет назад ». Честно говоря, мама Ми всегда предпочитала, чтобы дети учились вне дома - для Дэвисов мир был классной комнатой.

Майя вспоминает, как сидела на корточках на месте первого открытия золота в Калифорнии, Дуба Золотой Мечты, притворяясь старателем, пытаясь отыскать золотые хлопья. В другой раз Мья обнаружил, что роется в мешке с вулканическими породами, который его мама принесла домой на урок геологии.Вместе они взломали жеоды, обнажив сверкающие кристаллы. Это вызвало две недели поиска в Google таких вещей, как "Что такое осадочная порода?" и "Где я могу найти аметист?"

«Я даже не осознавала, насколько мое домашнее обучение повлияло на то, что я делаю, и на то, кем я являюсь сегодня», - сказала Майя. «Иногда нам даже не приходилось заканчивать урок из моей книги по саксонской математике для шестого класса, потому что мы собирались пойти в обсерваторию Гриффита. Моя мама говорила:« Я чувствую, что этот опыт повлияет на моего ребенка сегодня, поэтому гораздо больше, чем просто сидеть и читать эту ерунду.«

Во время некоторых экскурсий Миа ночевала в незнакомых местах.« Хорошо, я не оправдываю этого сейчас, но мы пошли в Морской мир », - нервно засмеялся он. ламантины чихали всю ночь. Они разбудили меня, и я подумал: «Как это вообще работает? Как ваша дыхательная система работает под водой? »

Как и во все поездки, Майя взял с собой альбом для рисования - подарок дяди Клива. Он покорно дождался, пока все уснут, прежде чем достать его, чтобы набросать все, что он видел в тот день.«Я только что помню, как был под этим огромным скелетом шерстистого мамонта. И я просто рисовал этот зевок. Я подумал:« Как эти ребра изгибаются? » Как сказал бы любой художник, рисование с натуры - одна из лучших основ, поэтому я благодарен за то, что побывал во множестве разных мест. Будь то архитектура, определенные виды растений или животных, я постоянно рисовал с натуры. Это позволило мне вытащить из воображения все, что я хочу ».

В ту неделю, когда мы болтали, у Ми было два проекта на палубе: один - арт-инсталляция Джорджа Флойда, созданная в сотрудничестве профессоров и студентов программы Ми в USC.Они планировали разделить изображение мистера Флойда и визуализировать каждую часть индивидуально, используя любую среду. Та же команда также разрабатывала и готовилась к отправке масок Black Lives Matter. «В обозримом будущем мы будем носить маски. Я рассматриваю одежду как возможность 24/7. Как холст».

Повсюду Майя находит новые места, чтобы выразить себя, вдохновить, вложить смысл в неиспользуемое пространство. Когда он сказал мне, что с нетерпением ждет возвращения в USC в наступающем учебном году, он большую часть времени говорил о книжной полке, которую принесет этот сосед по комнате.«Это будет живая, дышащая часть нашей квартиры, - пояснил он. - Так что всякий раз, когда люди приходят в гости, они могут рисовать на ней. Они могут рисовать на ней. О, она просто наполняется сама собой. в восторге от таких мелочей ".

Но даже с двумя своими проектами Миа признался, что чувствует себя ограниченным и творчески ограниченным в карантине. Я попросил его описать, что он из себя представляет, когда чувствует себя больше всего в нормальных обстоятельствах.

«О, Господи».

Мя на мгновение остановилась, чтобы задуматься.«Я бы сказал, что полностью становлюсь собой, когда я лично с другими. Хм, а потом я бы сказал, когда я тоже попаду в свежую среду », - сказал он.

В колледже Майя известен тем, что вдыхает жизнь в пространство вокруг себя. Он и его друзья могли прийти в класс пораньше и включить музыку через акустическую систему. «Мы бы просто затихли полностью», - объяснил его одноклассник Сумит. «Как сойти с ума, прямо перед уроком, танцами и всем остальным. Мы очень вспотели, и я всегда выходил счастливым, независимо от того, какое у меня было настроение раньше.В итоге мы взорвали один из динамиков ».

Даже когда мы говорили в июне 2020 года, на фоне разворачивающихся протестов и в стране, переживающей травму чернокожих, передаваемых из нескольких поколений, оптимизм Майи был безошибочным. Он выбирал каждое слово медленно, уверенно, настойчиво, серьезно: «Я всегда обращаю свое горе, особенно в последнее время, в вопрос типа:« Что я могу сделать? »Я рад, что мы что-то делаем в это время Черные жизни имеют значение, но что дальше? Я по-прежнему буду на передовой любого правосудия.

Радость Ми - его торговая марка, яркая даже в самых тонких деталях; по словам его друзей, каждый, с кем он сталкивается, получает широкую улыбку, теплый прием, попутный танец или все три; каждая мелочь говорит что-то вроде Я вижу тебя, ценю тебя и думаю, что у тебя все отлично. «Я хочу быть уверенным, что каждый, с кем я общаюсь, хоть как-то получал светлый день», - сказала мне Майя.

«Известно, что я безоговорочно оптимистичен», - объяснил он.«Я понятия не имею, сколько других людей разделяют мой взгляд на мир, но я всегда думаю, что действие может компенсировать плохое или сделать хорошее дело великим. Я всегда об этом думаю. Некоторые люди воспринимают это так: «Мя, почему ты никогда не злишься? Я никогда не слышал, чтобы ты кого-то ругал. Я никогда не видел, чтобы ты плакал. «Я действительно плачу редко», - сказал он, подняв брови в знак признательности. «Мне определенно нравится уязвимость. Но я никогда не застреваю ».

Мья объяснила, что его родители, Аннетт и Байрон Дэвис, показали ему, что доброта может быть формой силы, чему она научилась в свое время, когда они были профессиональными спортсменами.«Если вы хотите вникнуть в спортивную историю моей семьи, то моя мама и ее лучшая подруга и партнер по пляжному волейболу Дженни Джонсон Джордан приехали на Олимпиаду 2000 года в Сиднее. Мой отец, Байрон Дэвис, был всего на три десятых секунды от того, чтобы быть первым афроамериканцем в олимпийской сборной по плаванию. Мой отец научил меня не меняться для других, а, скорее, спрашивать: «, чем я могу быть вам полезен, ? Он потрясающий». - сказала Майя, ухмыляясь. «И как я могу забыть? Еще у меня есть крестная по имени Бетси.Она, прежде всего, сильна ». (Крестная мать Ми Бетси замужем за Рафером Джонсоном, опытным олимпийским десятиборьем.)

Байрон продолжал строить карьеру в области мотивационной речи и часто уезжал по делам. волейбол, Аннетт обучала Мию и его сестру на домашнем обучении в основном самостоятельно, уделяя большое внимание формированию их умы и духа. «И моя мама, и бабушка заставили меня хотеть [быть добрым]. Мне так много показали, а я, в свою очередь, так много хочу отдать ».

Аннетт выбрала домашнее обучение Ми за возможность разжигать естественные любопытства Ми.«Она связала базовые предметы с моими увлечениями и интересами, и я всегда буду благодарен ей за это», - объяснила Майя. Вместе у них была свобода глубоко погрузиться во все, что они хотели, а в некоторых случаях им приходилось бороться с материалом, который нельзя было найти в школах. Аннетт ежегодно проводила Месяц истории афроамериканцев, читая вслух Джеймса Болдуина и знакомя Миа с богатой историей африканской диаспоры. «Вы не получите этого в государственной школе», - сказала Майя, смеясь. «Вы получите, может быть, полторы главы о рабстве, но вы так много узнаете о происхождении европейской королевской семьи.

Обучение на дому означало, что Миа могла учиться в любом темпе, который был для него инстинктивным. Когда он хотел, он мог бегать по материалу или неторопливо исследовать каждый вопрос, который у него возникал. Природное усердие Ми помогло ему освоить математику, орфографию и писать рабочие тетради. Он ускорял уроки до тех пор, пока Аннетт больше не нужно было читать ему лекции, поэтому она поручила ему читать книги самостоятельно, что он быстро закончил, сократив учебный день. Это оставило день широко открытым для того, чтобы потеряться во всем, что еще привлекло внимание Майи.И как только он ударился о что-то, что находило отклик, ничто не могло вытащить его из этого. «Я хочу постоянно работать продуктивно, - сказала Миа. «Но я трачу много времени, просто погружаясь в вещи, потому что мне действительно любопытно множество странных, случайных вещей. Я спускаюсь в огромные кроличьи норы ».

Такому обучению настоятельно рекомендовал дядя Ми "Клив" Кливленд, кинорежиссер, которого Майя считает своим главным творческим наставником. Мия проводил много дней в доме своего дяди, где они вместе создавали всевозможные творческие среды; случайное, но глубокое погружение в GarageBand, Logic, среди других цифровых звуковых рабочих станций и программного обеспечения для редактирования; и ставить запись за записью для вдохновения.

«Мне нравится думать о нем как о своем« творческом отце », - объяснила Мя. «Он заставил меня полюбить музыку. Он заставил меня заниматься всем. А потом он говорил:« Пойдемте в кино. Я покажу вам всю классику кино ». И мы просто спустились и сделали это. Во мне было что-то, что звало меня и влекло в этот мир. Я подумал: «Есть люди, которые должны были это сделать». Я никогда не забуду, что на самом деле побудило меня просто взглянуть все глубже и глубже на то, как все взаимосвязано.

Мой дядя однажды отсутствовал. Я был в доме бабушки и шнырял, как дети. И я наткнулся на коллекцию комиксов моего дяди. И я подумал: «Эй, что это?» Я беру книгу Кальвина и Гоббса - Что-то под кроватью пускает слюни . Я даже не поняла слишком многих шуток », - призналась Мя. «Они пролетели над моей головой. Но я всю ночь читал эту книгу. На следующий день я принесла эту книгу своему дяде и спросила: «У тебя есть еще такие?» Он дал их мне, и эта доброта повлияла на меня.

Я хотел посмотреть, кто вдохновил Билла Уоттерсона стать Биллом Уоттерсоном. Итак, я пошел к Чарльзу Шульцу. Я заказал в своей библиотеке вещи, которых не было в городе. Я прочитал все комиксы о Peanuts. А потом я подумал: «Что дальше? Что дальше? На кого еще повлиял Чарльз Шульц? И какие еще удивительные творения появляются оттуда? »

Это тип исследования, который может происходить на курсах изучения кино; Ми было всего шесть лет. Когда он стал старше, он начал рассматривать эти дополнительные дневные часы как основы его творческого роста.«Домашнее обучение действительно позволило мне заняться этими усилиями так же глубоко, как я, - объяснил он. - Если бы я учился в государственной или даже частной школе, я бы был там с 8:00 до 3:00. Когда я поступил в государственную школу, в старшей школе я подумал: «В эти часы много времени я действительно в чьей-то повестке дня. И я узнаю кое-что полезное». Но в глубине души на протяжении всей старшей школы я знал, что мог бы использовать это количество времени, чтобы развить навыки, которые я хотел развить.Это дало мне домашнее обучение ».

В первый день девятого класса Майя стоял в кафетерии в West Ranch Valley High, чувствуя себя подавленным. Его путешествие на домашнее обучение закончилось; он хотел пройти путь и испытать типичную среднюю школу. Миа был обеспечен. Поскольку домашнее обучение позволяло ему выполнять уроки в своем собственном темпе, он на два года опережал класс по математике и на один год - по испанскому. И хотя у Мии раньше были дружеские отношения, это было другое - толпы студенты образовывались повсюду, раздуваясь, заполняя открытое пространство.Как он мог вписаться в эту толпу и где он мог сидеть за обедом, было неясно. Дети рассаживались по местам со всех сторон, и ванная казалась легкой. Вскоре Миа обнаружил, что ест свой PB&J над полосой ползающих муравьев.

Обеды в ванной длились две или три недели, пока у Ми не появился план завести ровно одного друга. Он решил попробовать то, что научился на домашнем обучении. Когда он не снимал комиксы и не смотрел фильмы, Миа проводил послеобеденные занятия на дому, поглощая все, что мог, о магии крупным планом.Он просмотрел все специальные статьи и учебники по магии, которые он нашел, проверил книги о трюках и самостоятельно практиковал ловкость рук.

Мя искренне улыбнулась. «Мой дедушка, Большой Папа, всегда любил играть в карты и делать карточные фокусы. Он умер, когда мне было шесть лет, но то, что связывает меня с ним, - это фокусы». Магия связала Мию с его дедушкой, и он подумал, что это может помочь ему наладить контакт и с одноклассником.

«Я начал делать карточные фокусы только для одного человека.Я подумал: «Если я смогу просто показать этот действительно крутой трюк одному человеку из PE, то, знаете ли, у меня будет прогресс», - сказала Миа. Он показал трюк своему однокласснику по имени Бретт. «Я делаю что-то, где переключаю карту, которую держу в руке, на его ногу. И он ошеломлен - носки - он босиком, - вспоминает Майя, гордо сияя, подняв руки, для подчеркивания. - Теперь он один из моих лучших друзей. В конце концов, меня окружает огромная толпа на перемене, и я делаю магические упражнения для девушки, в которую был влюблен… Я такой: «Как я сейчас здесь?» Магия была отличным инструментом, - засмеялся он.«Я имею в виду, я до сих пор этим занимаюсь».

Как объяснили его друзья, Миа тут же нашел свой социальный успех. «Его всегда можно было найти с колодой карт», - сказал Джоэл, один из бывших одноклассников Мии. «Он мог собирать толпы, будь то венецианская набережная, трибуны футбольного матча или задняя часть классной комнаты. Однажды он попросил учителя поучаствовать в трюке, и весь класс взбесился. Дело в том, что куда бы Миа ни шла, он мог говорить на этом языке. Он - определение «мастера на все руки» - за вычетом «мастера на все руки».

«Я слышу распространенный стереотип о том, что домашние школьники не преуспевают в социальном плане», - осторожно сказала Миа. «Оглядываясь назад, я был в порядке». Во время обучения на дому Майя был частью нескольких разных сообществ, в том числе бойскаутов, где он узнал о лидерстве; и несколько кооперативов, которые представляют собой группы семей, обучающихся на дому, которые организуют совместное обучение по определенным предметам. Классический кооператив, который преподавал логику как предмет, побуждал Мию критически анализировать аргументы, в то время как другой кооператив проводил групповые экскурсии и групповые мероприятия, наиболее запоминающимся из которых был День предпринимательства .

«Не знаю, было ли это в начальных школах», - сказала Мя. «Но в одном кооперативе было это событие, которое действительно пробудило во мне желание создавать свои собственные вещи. День предпринимательства позволил всем участникам кооператива продавать свои собственные творения, что бы они ни любили. Я подумал: «Эй, это фантастический шанс для меня попробовать написать свой собственный комикс». Майя написал комикс « The Davis Family » о семье Блэков, который он смоделировал после « The Simpsons » и его собственного дома.За одну неделю он сделал двадцать комиксов, и Аннетт отвела его в Кинко, чтобы делать копии в спиральном переплете. Это стали его первые тома. С помощью мамы Майя записал затраты на печать каждой копии, затем отнес свои книги на День предпринимательства, где он продал свои книги незнакомцам в киоске в парке, поставив свое имя на каждой обложке. «Это научило меня, что создание чего-либо и наличие предпринимательского мышления - это невероятное чувство».

Когда приходит время подумать о колледже, самые амбициозные старшеклассники выбирают специальность, которая открывает им четко определенный путь к стабильной карьере.Майя думал иначе, надеясь на такую ​​учебную среду, которая дала бы возможность его увлечениям в то же время процветать, что мало чем отличалось от его дней обучения на дому. Он искал программы, которые побуждали студентов мыслить за пределами четко определенных названий должностей и основываться на сырых идеях. «Вот почему моя программа в колледже понравилась мне больше всех других программ», - сказал Майя, говоря об Академии USC Iovine & Young, где он сейчас учится на втором курсе. «Они не дадут вам комплексного образования, а скорее инструменты, которые вы можете использовать, чтобы творить где угодно.Я подумал, - сказал Хватит. Я хочу поехать туда ».

Мя, кажется, нашел среду, которую искал. Когда я спросил некоторых из его одноклассников, как они его описали бы, каждый из них дал разные ответы:« У ребенка нет .

Опубликовано в категории: Разное

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *