Чем можно заменить растворитель р4: Какие аналоги имеет растворитель Р4 – ООО ДХЗ

Какие аналоги имеет растворитель Р4 – ООО ДХЗ

Опубликовано: 14.01.2022 Время чтения: 4 минуты 1467

Для выполнения малярных работ самого различного типа очень важное значение имеют такие вещества как растворители. Они необходимы для подготовки окрашиваемой поверхности и придания нужной консистенции лакокрасочному материалу. В данной статье будет рассмотрен один из наиболее популярных многокомпонентных растворителей, а именно растворитель Р4.

  Многокомпонентный растворитель марки Р4представляет собой белую прозрачную жидкость, иногда она может иметь желтый оттенок, без наличия видимых взвешенных частиц. Данный разбавитель характеризуется специфическим резким запахом и очень высокими показателями летучести.

Средний показатель относительной плотности растворителя Р4 – 0,85 г на куб. см. Температура воспламенения вещества составляет 550 градусов по Цельсию. Производство выполняется согласно стандарту ГОСТ 7827-74.

Растворитель Р 4 – состав, применение и аналоги.

Выше указанный гост распространяется не только на Р-4 растворитель, но и на такие марки как Р-4А, Р-12, Р-5, Р-5А. Все эти растворители представляют собой смесь органических летучих растворителей: кетонов, сложных эфиров, ароматических углеводородов. Основным их назначением считается разбавление перхлорвиниловых и иных ЛКМ.

Растворитель Р-4 предназначен для быстрого и эффективного разбавления ЛКМ на основе поливинилхлоридных хлорированных смол ПСХ ЛН и ПСХ ЛС, эпоксидных смол, сополимеров винилхлорида и иных пленкообразующих веществ (кроме серой и защитной эмали ХВ-124). Он состоит из 62% толуола, 26% ацетона и 12% бутилацетата. Одна из его разновидностей, растворитель Р-4А используется для разбавления ОКМ выполненных на таких же основах, как и в случае с Р-4.

Однако у этого растворителя есть одна очень важная особенность – его можно применять для разбавления эмалей ХВ-124.

Одним из наиболее распространенных аналогов Р4 состава считается растворитель марки Р-5, который используют для растворения лакокрасочных материалов, изготовленных на основе каучуков, кремнийорганических, полиакриловых, эпоксидных смол, а также смол ПСХ ЛН и ЛС. В его состав входит 40% толуола, 30% бутилацетата и 30% ацетона. Данный растворитель также имеет модификацию – это Р-5А, которая используется в том случае если все выше перечисленные составы исключают возможность использования растворителя марки Р-5.

Если вы не знаете, чем еще заменить растворитель Р-4, тогда растворитель Р-12 – это еще один тип разбавителя, которым можно заменить Р4 состав. Состав данного вещества следующий: 60% толуола. 30% бутилацетата и 10% ксилола. Его используют для разбавления тех же ПСХ ЛН и ЛС смол, а также полиакриловых смол и иных пленкообразующих ЛКМ.

Все растворители выше представленных марок должны изготовляться в соответствии с ГОСТами 31089-2003 и 7827-74, по технологическому регламенту и рецептуре, утвержденными в установленном порядке предприятия.

Физико-химические свойства растворителя Р4 и его аналогов.

Если вы используете растворитель р4, чем можно его заменить понять достаточно трудно, поскольку нужно знать определенные характеристики этого вещества. Для различных поверхностей и ЛКМ применяют разные растворители этой группы, поэтому по наиболее приближенным показателям физико-химических свойств можно подобрать подходящую замену Р4 растворителю.

Растворители Р-4 и Р4-А обладают следующими физико-химическими свойствами:

  • Показатель массовой доли воды по Фишеру не превышает 0,7%.
  • Летучесть растворителя по этиловому эфиру от 5 до 15.
  • Кислотное число составляет не более 0,07 мг КОН/г.
  • Процентное число коагуляции не меньше чем 24%.
  • Температура вспышки (находясь в закрытом тигле) не ниже -10°С для растворителя Р-4 и -8°С для Р-4А.

Рассмотрим физико-химические свойства растворителя Р-5 и Р-5А:

  • Показатель массовой доли воды по Фишеру не превышает 0,7%.
  • Летучесть растворителя по этиловому эфиру от 9 до 15.
  • Кислотное число составляет не более 0,07 мг КОН/г.
  • Процентное число коагуляции не меньше чем 30%.
  • Температура вспышки (находясь в закрытом тигле) не ниже -12°С для растворителя Р-5 и -3°С для Р-5А.

И наконец физико-химические свойства растворителя Р-12 имеют следующие значения:

  • Показатель массовой доли воды по Фишеру не превышает 1,0%.
  • Летучесть растворителя по этиловому эфиру от 8 до 14.
  • Кислотное число составляет не более 0,10 мг КОН/г.
  • Процентное число коагуляции не меньше чем 22%.
  • Температура вспышки (находясь в закрытом тигле) не ниже -22°С.

Упаковка растворителя Р4 и его аналогов, а также маркировка, хранение и транспортирование.

Перед тем как заменять Р4 состав на другой тип растворителя, очень важно ознакомиться с требованиями к маркировке, упаковки, хранения и транспортирования. Это связано с тем, что нужно придерживать техники пожарной безопасности в каждом из этих случаев поскольку хотя физико-химические показатели растворителей очень близки, даже сотые доли отклонения могут сыграть ключевую роль.

Все растворители этой группы упаковываются в металлическую тару с узким горлом (фляги, канистры, барабаны и бочки) согласно разработанным ГОСТам и другой технической документации. Те растворители, которые предназначены для розничной продажи можно упаковывать в специальные канистры емкостью до 10 дм3, в стеклянную тару, в металлические банки, в полимерную потребительскую тару, изготовленную из полиэтилентерефталата. Укупорочные средства для тары должны обеспечивать максимальную герметичность и быть стойкими к химическому воздействию растворителей.

Чем заменить растворитель марки р 4 при разбавлении эпоксидных смол – ООО ДХЗ

Опубликовано: 14. 01.2022 Время чтения: 2 минуты 170

Растворитель Р-4 представляет собой многокомпонентный растворитель, сочетающий в себе кетоны, ароматические углеводороды и эфиры. В состав этого разбавителя входит 62% толуола, 26% ацетона и 12% бутилацетата. Именно такое сочетание компонентов обеспечивает отличные потребительские свойства и максимально эффективное растворение ЛКМ.

Многокомпонентный растворитель марки Р-4 предназначен для разбавления ЛКМ на основе поливинилхлоридных хлорированных смол ПСХ ЛН и ПСХ ЛС, эпоксидных смол, сополимеров винилхлорида, а также других пленкообразующих материалов (кроме серой и защитной эмали ХВ-124).

Данная марка растворителя имеет следующие физико-химические показатели:

  • Процентная массовая доля воды (по Фишеру) не более 0,7%.
  • Показатель летучести по этиловому эфиру лежит в пределах от 5 до 15.
  • Кислотное число составляет 0,07 мг КОН/г.
  • Число коагуляции составляет не меньше ем 24%.

Благодаря высоким показателям физик-химических свойств растворитель р 4 является очень востребованным. По этой причине очень его просто раскупают с магазинных прилавков. В таком случае будет очень полезно знать, каким растворителем можно заменить р-4.

Все зависит от области применения это состава. Наиболее подходящими растворителями для замены считаются Р-4А, Р-5, Р-5А и Р-12. Рассмотрим каждый из них более подробно.

Растворитель Р-4А считается аналогом обычного Р-4, однако его можно использовать для разбавления эмалей ХВ-123 защитной и серой. Поэтому если в магазине нет обычного Р-4 растворителя, вы можете уверенно покупать Р-4А.

Если вам нужно разбавить ЛКМ на основе смол ПСХ ЛН, ПСХ ЛС и эпоксидных смол, тогда можно использовать растворитель марки Р-5.

Для таких же целей можно применить растворитель Р-5А. Конечно, эти вещества обладают и другими свойствами, который присущие только им, однако нас интересует замена растворителя Р-4, поэтому основываемся только на области его применения.

Многокомпонентный растворитель марки Р-12 рационально использовать только в случае разбавления ЛКМ на основе ПСХ ЛН и ПСХ ЛС смол. Кроме этих смол он способен разбавить и другие пленкообразующие вещества, включая и эпоксидные смолы, сополимеры винилхлорида, эмаль ХВ-124, однако качество выполненной работы будет на порядок ниже. Этак касается всех растворителей, который способны в некоторой мере заменить Р4. Поэтому если вам нужно выполнить работу максимально качественно, то лучше всего подождать пока в магазине появится именно р-4 растворитель.

Растворитель р 4 чем можно заменить


Чем можно заменить растворитель Р-4.

Для выполнения малярных работ самого различного типа очень важное значение имеют такие вещества как растворители. Они необходимы для подготовки окрашиваемой поверхности и придания нужной консистенции лакокрасочному материалу. В данной статье будет рассмотрен один из наиболее популярных многокомпонентных растворителей, а именно растворитель Р4.

Многокомпонентный растворитель марки Р4 представляет собой белую прозрачную жидкость, иногда она может иметь желтый оттенок, без наличия видимых взвешенных частиц. Данный разбавитель характеризуется специфическим резким запахом и очень высокими показателями летучести. Средний показатель относительной плотности растворителя Р4 – 0,85 г на куб. см. Температура воспламенения вещества составляет 550 градусов по Цельсию. Производство выполняется согласно стандарту ГОСТ 7827-74.

Растворитель Р 4 – состав, применение и аналоги.

Выше указанный гост распространяется не только на Р-4 растворитель, но и на такие марки как Р-4А, Р-12, Р-5, Р-5А. Все эти растворители представляют собой смесь органических летучих растворителей: кетонов, сложных эфиров, ароматических углеводородов. Основным их назначением считается разбавление перхлорвиниловых и иных ЛКМ.

Растворитель Р-4 предназначен для быстрого и эффективного разбавления ЛКМ на основе поливинилхлоридных хлорированных смол ПСХ ЛН и ПСХ ЛС, эпоксидных смол, сополимеров винилхлорида и иных пленкообразующих веществ (кроме серой и защитной эмали ХВ-124). Он состоит из 62% толуола, 26% ацетона и 12% бутилацетата. Одна из его разновидностей, растворитель Р-4А используется для разбавления ОКМ выполненных на таких же основах, как и в случае с Р-4. Однако у этого растворителя есть одна очень важная особенность – его можно применять для разбавления эмалей ХВ-124.

Одним из наиболее распространенных аналогов Р4 состава считается растворитель марки Р-5, который используют для растворения лакокрасочных материалов, изготовленных на основе каучуков, кремнийорганических, полиакриловых, эпоксидных смол, а также смол ПСХ ЛН и ЛС. В его состав входит 40% толуола, 30% бутилацетата и 30% ацетона. Данный растворитель также имеет модификацию – это Р-5А, которая используется в том случае если все выше перечисленные составы исключают возможность использования растворителя марки Р-5.

Если вы не знаете, чем еще заменить растворитель Р-4, тогда растворитель Р-12 – это еще один тип разбавителя, которым можно заменить Р4 состав. Состав данного вещества следующий: 60% толуола. 30% бутилацетата и 10% ксилола. Его используют для разбавления тех же ПСХ ЛН и ЛС смол, а также полиакриловых смол и иных пленкообразующих ЛКМ.

Все растворители выше представленных марок должны изготовляться в соответствии с ГОСТами 31089-2003 и 7827-74, по технологическому регламенту и рецептуре, утвержденными в установленном порядке предприятия.

Физико-химические свойства растворителя Р4 и его аналогов.

Если вы используете растворитель р4, чем можно его заменить понять достаточно трудно, поскольку нужно знать определенные характеристики этого вещества. Для различных поверхностей и ЛКМ применяют разные растворители этой группы, поэтому по наиболее приближенным показателям физико-химических свойств можно подобрать подходящую замену Р4 растворителю.

Растворители Р-4 и Р4-А обладают следующими физико-химическими свойствами:

  • Показатель массовой доли воды по Фишеру не превышает 0,7%.
  • Летучесть растворителя по этиловому эфиру от 5 до 15.
  • Кислотное число составляет не более 0,07 мг КОН/г.
  • Процентное число коагуляции не меньше чем 24%.
  • Температура вспышки (находясь в закрытом тигле) не ниже -10°С для растворителя Р-4 и -8°С для Р-4А.

Рассмотрим физико-химические свойства растворителя Р-5 и Р-5А:

  • Показатель массовой доли воды по Фишеру не превышает 0,7%.
  • Летучесть растворителя по этиловому эфиру от 9 до 15.
  • Кислотное число составляет не более 0,07 мг КОН/г.
  • Процентное число коагуляции не меньше чем 30%.
  • Температура вспышки (находясь в закрытом тигле) не ниже -12°С для растворителя Р-5 и -3°С для Р-5А.

И наконец физико-химические свойства растворителя Р-12 имеют следующие значения:

  • Показатель массовой доли воды по Фишеру не превышает 1,0%.
  • Летучесть растворителя по этиловому эфиру от 8 до 14.
  • Кислотное число составляет не более 0,10 мг КОН/г.
  • Процентное число коагуляции не меньше чем 22%.
  • Температура вспышки (находясь в закрытом тигле) не ниже -22°С.

Упаковка растворителя Р4 и его аналогов, а также маркировка, хранение и транспортирование.

Перед тем как заменять Р4 состав на другой тип растворителя, очень важно ознакомиться с требованиями к маркировке, упаковки, хранения и транспортирования. Это связано с тем, что нужно придерживать техники пожарной безопасности в каждом из этих случаев поскольку хотя физико-химические показатели растворителей очень близки, даже сотые доли отклонения могут сыграть ключевую роль.

Все растворители этой группы упаковываются в металлическую тару с узким горлом (фляги, канистры, барабаны и бочки) согласно разработанным ГОСТам и другой технической документации. Те растворители, которые предназначены для розничной продажи можно упаковывать в специальные канистры емкостью до 10 дм3, в стеклянную тару, в металлические банки, в полимерную потребительскую тару, изготовленную из полиэтилентерефталата. Укупорочные средства для тары должны обеспечивать максимальную герметичность и быть стойкими к химическому воздействию растворителей.

Растворитель Р-646, Р-4, Р-5, Уайт-спирит, Сольвент нефтяной, ацетон.

Растворитель – это смесь летучих органических растворителей: ароматических углеводородов, кетонов, спиртов и эфиров.

Растворитель представляет собой вещество органического или неорганического происхождения, обладающее свойствами растворять разнообразные вещества. После его испарения первоначальная структура растворяемого материала восстанавливается. Растворители придают лакокрасочным материалам нужную малярную вязкость. 

Каждый растворитель пригоден при работе только с определенной группой красок: 

с масляными красками — бензин, уайт-спирит, скипидар, керосин; 

с глифталевыми, битумными лаками и красками — сольвент-нафтяной, скипидар, ксилол; 

с перхлорвиниловыми — ацетон. 

Для бытовых нужд и снятия лакокрасочных покрытий применяются смывки. Растворитель особенно необходим в строительстве, при проведении ремонтных работ, им разводят различные красящие вещества, удаляют загрязнения.

Растворитель Р-646 ГОСТ 18188-72 применяется для разбавления нитрокрасок, нитроэмалей, нитрошпатлевок общего назначения, в том числе автомобильных.

Растворитель Р-4 ГОСТ 7827-74 применятся для разбавления лакокрасочных материалов на основе поливинилхлоридных смол ПСХ ЛС и ПСХ ЛН, сополимеров винилхлорида, эпоксидных смол и других пленкообразующих веществ (за исключением эмали ХА-124 серой и защитной).

Растворитель Р-5 ГОСТ 7827-74 применяется для разбавления перхлорвиниловых, эпоксидных, кремний-органических, полиакрилатных лакокрасочных материалов, а также каучуков.

Уайт-спирит ГОСТ 3134-78 применяется для разбавления масляных красок, эмалей и лаков, а также лакокрасочных материалов, грунтовок, олифы и битумных материалов, а так же шпатлевок марок: МЛ, МЧ, ПФ, МС, ВН .

Ацетон ГОСТ 2768-84 применяется для растворения природных смол, масел, диацетата целлюлозы, полистирола, эпоксидных смол, сополимеров винилхлорида, полиакрилатов, хлоркаучука, для обезжиривания поверхностей, для синтеза уксусного ангидрида, ацетонциангидрина, дифенилолпропана и других органических продуктов.

Сольвент нефтяной ГОСТ 10214-78 применяется для растворения битумов, масел, каучуков и других веществ. Формальдегидные, полиакрилатные, меламиноалкидные, кремнийорганические, алкидно-стирольные, алкидно-уретановые, эпоксиэфирные лакокрасочные материалы доводят до рабочей кондиции, растворяя их сольвентом. Он также входит в состав таких смесевых растворителей как РЭ-2В, РЭ-3В, РЭ-4В и др.

Растворитель

Назначение

Растворяемые пленкообразователи

Основные марки лакокрасочных материалов

Растворитель 646

Нитратцеллюлозные  Нитратцеллюлозно-глифталевые  Эпоксидные  Нитратцеллюлозно-эпоксидные  Мочевино (меламино)-  Формальдегидные 

Кремнийорганические

Лаки:              НЦ-269, НЦ-279, НЦ-291; НЦ-292; НЦ-299; НЦ-5108; НЦ-524

Эмали:   НЦ-170, НЦ-184, НЦ-216, НЦ-217, НЦ-25, НЦ-246, НЦ-258, НЦ-262, НЦ-271, НЦ-273,НЦ-1104, НЦ-282, НЦ-929, НЦ5100. НЦ-5123, нитроэмали для груз. авт.

Нитроэмали:  №924, ЭП-773, КО-83, НЦ1124, НЦ-1120

Грунтовки:              НЦ-081, МС-067, МЧ-042

Шпатлевки:  НЦ-008, НЦ-009, ЭП-0010, ЭП-0020

Растворители Р-4

Перхлорвиниловые  Полиакрилатные  Сополимеры 

винилхлорида

Лаки:              ХС-76, ХС724, ХВ-782, ХСЛ

Эмали:              ХВ-16, ХВ-112, ХВ-124, ХВ-125, ХВ-142, ХВ-179, ХВ-518, ХВ-519, ХВ-553, ХВ-714, ХВ-750, ХВ-1100, ХВ-785, ХВ-1120, ПХВО-4, ХВ-1149, ХВ-5169, ХС-119, ХС-527, ХС-710, ХС-717, ХС-720,ХС-724, ХС-747, ХС-748, ХС-759, ХС-781, ХС-5163

Грунтовки:              ХВ-062, ХВ-079, ХС-010, ХС-059, ХС-068, ХС-077, МС-067

Шпатлевки:  ХВ-004, ХВ-005, ЭП-0020

Растворитель Р-5

Перхлорвиниловые  Эпоксидные  Кремний-  органические  Полиакрилатные 

каучуки

Лаки:              ХВ-139, АС-16, АС-82, АС-516, АС-552, АК-113

Эмали:              ХВ-124, ХВ-125, ХВ-160, ХВ-16, ХВ-782, ХВ-536, ХС-1107, АС -131, АС-560, АС-599, АК-192, ЭП-56, ЭП-140, ЭП-255, ЭП-275, ЭП-525, ЭП-567, КЧ-767, КО-96, КО811, КО-814, КО-818, КО-822, КЩ-841

Грунтовки:  АК-069, АК-070, ЭП-0104

Шпатлевки:              ЭП-0020, ЭП-0026, ЭП-0028

Сольвент, уайт-спирит

Пентафталевые

Эмаль ПФ-115 различных цветов

Вместе с этим читают: 

Растворители для разведения лакокрасочных материалов и их заменители

Категория:

   Окрасочные работы в машиностроении

Растворители для разведения лакокрасочных материалов и их заменители

Какими соображениями руководствуются при выборе растворителей для разведения лакокрасочных материалов?

Выбирая растворитель, учитывают рекомендации, приведенные в ГОСТах или ТУ. В отдельных случаях прибегают к справочным данным о взаимозаменяемости растворителей.

Какой высококипящий растворитель пригоден для разбавления нитроцеллкэлозных материалов?

Менее пожароопасный растворитель состоит из 30% смеси диоксоланов, 20% изо-бутилового спирта и 50% ксилола. Температура кипения диоксоланов 82 °С, а вспышки 210 — 230 °С.

Можно ли использовать хладоны в качестве растворителей?

Да, но при строгом соблюдении мер предосторожности. Хладон-30 и хладон-113 при попадании на кожу могут вызвать ожоги. Хладон-113 негорючий, взрывобезопасный, при соприкосновении с огнем или горячими поверхностями разрушается, образуя высокотоксичные продукты термической деструкции (фосген).

Можно ли использовать растворитель 646 для разбавления эмали ВЛ-515?

С введением растворителя 646 ухудшаются физико-механические и эксплуатационные свойства покрытия. Эмаль следует разбавлять только растворителем Р-60.

Можно ли бакелитовые лаки разводить ацетоном?

Нет. В эти лаки можно вводить спирт этиловый денатурированный или гидролизный, а также спирт изопропиловый.

Какими растворителями можно заменить спирт этиловый ректйфикат в спиртовых изоляционных и шеллачных лаках?

Взамен спирта этилового ректификата используют спирт изопропиловый, этило-выи денатурированный или гидролизныи.

Можно ли для разведения грунтовки ГФ-021 использовать растворитель 646, а для ГФ-0163 — толуол?

Нет. Применение растворителя 646 ухудшает качество грунтовки ГФ-021. Разводить эту грунтовку можно ксилолом, сольвентом, смесью тяжелого растворителя с уайт-спиритом в соотношении 1:1. Замена ксилола или сольвента при разведении грунтовки ГФ-0163 часто становится причиной растрескивания покрытия.

Какими растворителями заменяют ксилол при разведении эмалей МЛ-12 и МЛ-165? Пригоден ли для этих целей бензин?

В эти эмали вводить бензин нельзя. Для разведения можно использовать сольвент, разбавитель Р-5, растворитель 646.

Можно ли при электростатическом окрашивании вводить бутилацетат в грунтовку МЧ-042 или эмаль МЛ-242?

Рис. 1. Пленка эмали, в которую введены растворители Р-60 (а) и 646 (б)

Нет. Необходимо использовать растворители РЭ-1В, РЭ-2В, РКБ.

Можно ли нитроэмаль НЦ-12 или НЦ-132 разводить ацетоном, а эмаль НЦ-218-растворителем 646 или 647?

Нет. Ацетон заметно снижает адгезию наносимых эмалей. Нитроэмаль НЦ-132 следует разводить растворителем 646 или 649, НЦ-11 — только растворителем 647, поскольку введение растворителя 646 ухудшает качество этой эмали. Для эмали НЦ-218 пригоден лишь растворитель РМЛ-218. Использовать растворители других марок запрещается.

Какими растворителями разводят нитроэмали и эмали типа НКО?

Для нитроэмалей лучшие результаты дает использование растворителя 647. Кистевые эмали типа НКО разбавляют растворителями 649 или 650, при нанесении эмалей краскораспылителем — растворителями 646 или 647.

Разрешается ли разводить бензином алкидные эмали ПФ-115, ПФ-167, ПФ-218 и аналогичные им?

Нет. Можно использовать сольвент, уайт-спирит или смесь равных частей сольвента и уайт-спирита.

Каким растворителем можно разводить лак ПФ-231?

Скипидаром, смесью равных частей сольвента и уайт-спирита, тяжелым растворителем, уайт-спиритом.

Разрешается ли разбавлять шпатлевку ПФ-002?

Введение растворителей в шпатлевку может увеличить хрупкость и снизить ее адгезию. В связи с этим используют смесь из алкидного лака с уайт-спиритом. При нанесении шпатлевки краскораспылителем применяют скипидар, смесь уайт-спи-рита с сольвентом в соотношении 1:1.

Чем заменяют растворитель Р-4 и разбавитель Р-5 при разведении перхлорвиниловых эмалей?

Для эмалей ХВ-16, ХВ-24, ХВ-25, ХВ-1100, ХВ-113, ХВ-170, ХВ-238 и ХВ-785 можно использовать сольвент.

Эмали других марок следует разбавлять растворителями, рекомендованными в технической документации.

Почему эмаль ХВ-16 рекомендуют разводить преимущественно разбавителем Р-5, а эмали других марок — растворителем Р-4?

Разбавитель Р-5 обладает меньшей упругостью паров, поэтому при нанесении эмали краскораспылителем покрытие получается с лучшим розливом, т. е. более гладким. Поскольку эмаль ХВ-16 наносят преимущественно краскораспылителем, в нее рекомендуется вводить разбавитель Р-5. Вообще же растворитель Р-4 и разбавитель Р-5 считаются взаимозаменяемыми.

Чем для эмали ХВ-124 можно заменить растворитель Р-4 при отсутствии его аналога, т. е. разбавителя Р-5?

При окрашивании изделий ответственного назначения замена растворителя Р-4 не допускается. В других случаях с учетом того, что покрытие будет иметь пониженное качество, используют сольвент или смесь его с растворителем Р-4 в любой пропорции.

Чем можно заменить растворитель РС-1 при разведении лака ХВ-152?

Допускается замена растворителем Р:4.

Чем для эмали ХВ-1120 можно заменить растворитель Р-12?

Взамен растворителя Р-12 можно использовать РС-1 или Р-4. Последним допустимо разводить эмали, используемые при окрашивании менее ответственных деталей.

Можно ли разводить шпатлевку ХВ-005 растворителем Р-4 или разбавителем Р-5?

Нет. Загустевшую шпатлевку разрешается разводить смесью из равных частей пленкообразующей основы шпатлевки с растворителем Р-4 или разбавителем Р-5.

Можно ли разбавлять эмали ФЛ-582 бензином Б-70?

Нет. Вводить в эмаль бензин недопустимо. Для разбавления можно применить растворитель РС-2 (смесь из 30 массовых частей ксилола и 70 массовых частей уайт-спирита).

Чем можно заменить для эмали ЭП-525 разбавитель Р-5?

Замена разбавителя Р-5 растворителем или разбавителем другой марки не допускается.

Можно ли разбавлять глифталевую эмаль ГФ-1426 бензином?

Нет. Можно использовать сольвент, ксилол, смесь равных частей сольвента или ксилола с уайт-спиритом.

Можно ли вводить дополнительные компоненты в промышленные сорта сложных растворителей (РДВ, 647, РМЛ-315 и др.) для получения растворителя, по свойствам равноценного Р-197?

Самостоятельное изготовление заменителей растворителя Р-197 недопустимо.

Какие растворители способны заменить четыреххлористый углерод?

Можно использовать трихлорэтилен или тетрахлорэтилен.

Какой растворитель, кроме Р-40, можно вводить в эпоксидную шпатлевку?

Для снижения вязкости в эпоксидную шпатлевку можно вводить толуол, этилцеллозольв и смесь из равных частей этих растворителей.

Чем можно заменить уайт-спирит при промывании поверхностей, загрязненных минеральными маслами?

Моющими композициями КМ-1, КМ-3, КМ-5, а также щелочными обезжиривающими растворами.

Какой растворитель пригоден для замены Р-189 в полиуретановых лаках УР-293 и УР-294?

Ксилол. Можно ли вместо органических растворителей применять для обезжиривания растворы моноэтаноламина?

Считалось, что водные растворы, содержащие 1% моноэтаноламина (МЭА) и 0,5% ОП-7 безвредны и обладают лучшей обезжиривающей способностью, чем уайт-спирит. Ошибочность этой точки зрения была обоснована в работе. Маслоемкость моющих растворов, содержащих 1% МЭА, 1% ОП-Ю и 98% воды, ниже, чем водных растворов фосфата и карбоната натрия. Моноэтаноламин является только эффективным ингибитором коррозии стали.

Как повышают обезжиривающую способность бензина, уайт-спирита и аналогичных по свойствам растворителей?

Обезжиривающую способность растворителей улучшают введением антистатических присадок, повышающих удельную объемную электрическую проводимость не менее чем на 10 См/м. Согласно требованиям техники безопасности, количество вводимых спиртов, кетонов и других добавок должно быть не меньше 15%, но в этом случае обезжиривающий растворитель может вызывать разрушение грунтовок. Используя некоторые неорганические соли, можно применять моющие композиции с меньшим содержанием антистатических присадок.

Реклама:
Читать далее: Материалы, наносимые в электрическом поле, безвоздушным распылением или окунанием

Категория: — Окрасочные работы в машиностроении

Главная → Справочник → Статьи → Форум

Чем заменить растворитель марки р 4?

Растворитель Р-4 представляет собой многокомпонентный растворитель, сочетающий в себе кетоны, ароматические углеводороды и эфиры. В состав этого разбавителя входит 62% толуола, 26% ацетона и 12% бутилацетата. Именно такое сочетание компонентов обеспечивает отличные потребительские свойства и максимально эффективное растворение ЛКМ.

Многокомпонентный растворитель марки Р-4 предназначен для разбавления ЛКМ на основе поливинилхлоридных хлорированных смол ПСХ ЛН и ПСХ ЛС, эпоксидных смол, сополимеров винилхлорида, а также других пленкообразующих материалов (кроме серой и защитной эмали ХВ-124).

Данная марка растворителя имеет следующие физико-химические показатели:

  • Процентная массовая доля воды (по Фишеру) не более 0,7%.
  • Показатель летучести по этиловому эфиру лежит в пределах от 5 до 15.
  • Кислотное число составляет 0,07 мг КОН/г.
  • Число коагуляции составляет не меньше ем 24%.

Благодаря высоким показателям физик-химических свойств растворитель р 4 является очень востребованным. По этой причине очень его просто раскупают с магазинных прилавков. В таком случае будет очень полезно знать, каким растворителем можно заменить р-4.

Все зависит от области применения это состава. Наиболее подходящими растворителями для замены считаются Р-4А, Р-5, Р-5А и Р-12. Рассмотрим каждый из них более подробно.

Растворитель Р-4А считается аналогом обычного Р-4, однако его можно использовать для разбавления эмалей ХВ-123 защитной и серой. Поэтому если в магазине нет обычного Р-4 растворителя, вы можете уверенно покупать Р-4А.

Если вам нужно разбавить ЛКМ на основе смол ПСХ ЛН, ПСХ ЛС и эпоксидных смол, тогда можно использовать растворитель марки Р-5. Для таких же целей можно применить растворитель Р-5А. Конечно, эти вещества обладают и другими свойствами, который присущие только им, однако нас интересует замена растворителя Р-4, поэтому основываемся только на области его применения.

Многокомпонентный растворитель марки Р-12 рационально использовать только в случае разбавления ЛКМ на основе ПСХ ЛН и ПСХ ЛС смол. Кроме этих смол он способен разбавить и другие пленкообразующие вещества, включая и эпоксидные смолы, сополимеры винилхлорида, эмаль ХВ-124, однако качество выполненной работы будет на порядок ниже. Этак касается всех растворителей, который способны в некоторой мере заменить Р4. Поэтому если вам нужно выполнить работу максимально качественно, то лучше всего подождать пока в магазине появится именно р-4 растворитель.



технические характеристики и состав, плотность и применение, аналоги и популярные марки

Применение лаков и красок в производстве и быту часто бывает неудобным из-за их большой густоты и вязкости. Это неудобство легко снимает растворитель.

А также он нужен, чтобы удалить пятна от краски, обезжирить поверхности, вымыть кисти после работы. Со всеми этими задачами прекрасно справится Р-4.

Особенности и состав

Любой растворитель либо принадлежит к группе активных химических веществ, либо является смесью из нескольких компонентов. Такую смесь из веществ органического происхождения и представляет собой Р-4.

Он выглядит как прозрачная бесцветная или желтоватая жидкость, в которой отсутствует осадок или взвешенные частицы. Вещество имеет резкий характерный запах.

Он приобрел большую популярность, так как имеет хорошие потребительские свойства. Продается Р-4 в любом специализированном магазине по доступной цене. Кроме того, имея широкую сферу применения, он очень прост в использовании. Описание способа применения и состав обычно указываются в инструкции, находящейся на емкости с веществом.

Одна из особенностей Р-4 – это возможность его применения для разведения практически любых лакокрасочных материалов, делая экономичным их использование. И также Р-4 придает им способность более быстрого высыхания, а при высыхании образует гладкую блестящую пленку, предотвращающую выцветание покрытия.

Нужно следить, чтобы в процессе работы в растворитель не попала вода. Она будет смешиваться с ацетоном, и это приведет к появлению белых пятен на окрашенной поверхности после высыхания.

Ацетон и толуол – это обязательные ингредиенты в составе растворителя. Их в Р-4 26 и 62% соответственно. Они расширяют сферу его применения. И также в состав добавляется бутилацетат, который помогает предохранять от выцветания окрашенные поверхности.

Однако эти вещества никак нельзя назвать полезными для организма человека. Хотя попадание растворителя на кожу не вызывает ожогов, длительный контакт с ним и вдыхание паров не пройдет бесследно: могут случиться отравление, головокружение, кашель, возникают дерматиты.

Поэтому при работе с растворителем следует принимать меры для защиты органов дыхания. А также нужно избегать попадания жидкости в глаза. Работы следует проводить в хорошо проветриваемом помещении; нелишними будут перчатки или рукавицы.

Технические характеристики

Растворитель Р-4 – это летучее самовоспламеняющееся вещество. Однако самовозгорание происходит при довольно высокой температуре – выше 500 градусов С. Тем не менее это легковоспламеняющееся вещество, и в обращении требует осторожности. Вблизи него не следует курить, недопустим открытый огонь и появление искр.

Следует учитывать такой немаловажный показатель, как температура вспышки. Этим термином обозначают такой показатель температуры, при котором пары растворителя в смеси с парами воздуха воспламеняются в присутствии открытого огня. Для Р-4 температура вспышки составляет -7 градусов С.

При производстве вещество упаковывают в тару, стенки которой не будут вступать с ним в химическую реакцию. Обычно это стеклянная или пластиковая упаковка. Хранить растворитель нужно в темных помещениях, где налажена хорошая вентиляция, чтобы на него не воздействовали прямые солнечные лучи и влага. Тара должна быть плотно закрытой, а рядом не должно быть электрических и отопительных приборов.

Технические характеристики растворителя определяются ГОСТами. Они, как правило, указываются на упаковке. Для Р-4 это:

  • коагуляционное число – 24%;
  • часть воды – 0,7%;
  • летучесть – 5-15;
  • плотность – 0,85 м3;
  • температура воспламенения – 550 градусов С;
  • температура вспышки – минус 7 градусов С.

Фасовка растворителя может быть мелкой и крупной. Это зависит от того, где он будет применяться.

Для бытового применения он поступает в продажу в емкостях по 0,5, 1, 3, 5,10, 20 литров. В бутылке емкостью 0,5 литра вес продукта составит 0,4 кг. В прочих емкостях – 0,7, 2,2, 3,7, 7,2, 14 кг соответственно указанным объемам.

Для промышленного применения используется крупная фасовка. Она может быть 100 и 216 литров. В ней вес продукта составит 72 и 165 кг соответственно.

У различных производителей объем тары и вес в ней продукта может отличаться. Производители устанавливают гарантийный срок хранения продукта в один год со дня изготовления.

Сфера применения

Р-4 чрезвычайно популярен среди людей, занимающихся ремонтом помещений, так как он практически универсален и необходим при широком спектре работ.

Чаще всего его используют для малярных работ, так как он весьма эффективен для высокой растворяемости лакокрасочных материалов, используемых при отделке помещений. Его специально разрабатывали для материалов, в основе которых лежат винилхлорид, эпоксидные, поливинилхлоридные и хлорированные смолы. Он подходит, когда нужно разбавить или растворить синтетические или натуральные пленкообразующие составы.

Следует заметить, что применение растворителя заметно снижает траты на ремонтные работы, так как его цена невелика, а расход краски в более жидкой консистенции значительно снижается. Качество окрашивания при этом не страдает.

Хотя основное назначение растворителя – разбавление лаков и красок, его можно применять для очистки и обезжиривания поверхностей. Для этого их протирают ветошью, смоченной растворителем.

Загрязнения сходят очень легко, а растворитель быстро испаряется, оставляя тонкую пленку. Образовавшаяся пленка – это отличное защитное покрытие, которое обеспечит последующее качественное окрашивание поверхности.

Чтобы кисти и другие инструменты не были испорчены, после работы их надо вымыть. Однако это не удастся сделать с помощью воды и мыла. Р-4 и здесь придет на помощь.

Обезжиривание также необходимо для многих других работ, не связанных с окрашиванием. Например, для последующего нанесения клея или других составов при ремонте обуви, мебели или приборов, при склеивании отбитых фрагментов. Процедуру обезжиривания можно проводить с помощью Р-4.

Производители

Сегодня на рынке много производителей, которые среди прочей продукции выпускают растворители.

Одно из крупнейших российских предприятий – Дмитриевский химический завод.

Его история началась более века назад. В 1899 году небольшую мануфактуру, производящую уксусную кислоту и ее соли, основал Савва Морозов. За долгий путь развития она превратилась в современную компанию, которая выпускает продукцию для разных отраслей промышленности. Предприятие продолжает развиваться и следит за своей репутацией, осуществляя контроль над качеством продукции на каждом этапе ее изготовления. Поэтому многие продукты, среди которых Р-4, востребованы не только на внутреннем рынке, но и в 70 странах мира.

Другой известный крупный производитель – это белорусский завод «Нафтан».

Это относительно молодое предприятие, его строительство началось в 1958 году. Днем его рождения считают 9 февраля 1963 года, когда впервые в Беларуси был произведен бензин. Предприятие развивалось семимильными шагами, на нем постоянно совершенствуются технологии, повышается эффективность производственных процессов.

Кроме производственных мощностей, завод имеет систему резервуарных парков, эстакаду, где принимают сырье и отгружают продукцию, а также развитую транспортную сеть вместе с железной дорогой.

Завод производит ассортиментный ряд продуктов из 70 наименований для разных отраслей промышленности. В списке продуктов есть разные марки растворителей, в том числе Р-4. Для бытового использования продукт фасуется в стеклянные бутылки емкостью 1 и 2 литра.

Расход

Чтобы нанесенная краска позже не начала отслаиваться из-за неравномерного нанесения и комков, она должна лечь на поверхность ровным слоем. Добавленный растворитель позволит решить эту задачу.

Для определения расхода растворителя существуют нормативные документы. Некоторое время назад ими было удобно пользоваться. Однако в настоящее время существует огромный ассортимент красок и их изготовителей, поэтому следует обязательно пользоваться рекомендациями от производителя. Для каждого вида лакокрасочных изделий могут быть свои нюансы. Во внимание могут приниматься материал окрашиваемой поверхности, температура и влажность окружающей среды, вид и «возраст» краски, эмали, грунтовки или лака и их марка, способ нанесения.

Например, для лака ХВ-784 или эмалей ХВ-124 и ХВ-125 понадобится 50% растворителя от массы краски или лака для нанесения пневматическим способом и 25-35% – безвоздушным. Кистью эти продукты не наносят. Если эти эмали вы будете наносить кистью, то расход растворителя составит 13-15%.

Чтобы узнать, сколько вам понадобится растворителя, сначала следует рассчитать необходимое количество краски. Изготовители, как правило, указывают на упаковках информацию о размере площади, для которого понадобится 1 кг или 1 л краски. Более удобно пользоваться показателем расхода материала на 1 м2. Обычно эти показатели отличаются не только для разных видов краски, но и для разных цветов краски одного вида.

Для масляных составов также важен показатель укрывистости. Он показывает, какой должна быть толщина высохшего слоя после окрашивания, при которой этот слой не будет прозрачным. Все эти показатели учитывают количество готового, то есть разведенного, состава. Высчитав его количество с учетом площади и качества поверхности, вы сможете рассчитать, сколько нужно купить краски и расход растворителя.

Например, для отделки помещения вам необходимо 10 л состава. Если вы будете наносить краску экономичным пневматическим способом (где нужно 50% растворителя), то путем не самых хитрых вычислений вы определите соотношение составных частей. Так как в данном случае вы берете 100% краски и 50% растворителя, то в 10 л они составят 150%. Составьте пропорцию и произведите расчеты. Окажется, что растворителя нужно примерно 3,3 л, а краски – 6,6 л.

Если вы используете кисть, когда для смешивания нужно 15% растворителя, то на 10 л его придется 1,3 л, а на краску – 8,7. Не забудьте, что после работы вам потребуется вымыть кисточку и оттереть возможные загрязнения.

Чтобы правильно подготовить лакокрасочный материал, в него надо добавлять небольшие порции растворителя, пока лак или краска не приобретет подходящую консистенцию. При этом требуется постоянное перемешивание состава.

Аналоги

Если случилось, что весь растворитель закончился, а в ближайшем магазине Р-4 не оказалось, то беда небольшая.

Закончить работу можно, используя его аналоги.

  • Прежде всего, обратите внимание на Р-4А. Он обладает теми же свойствами, что и Р-4, это его ближайший аналог. У них схожий состав и области применения. От Р-4 он отличается отсутствием в составе бутилацетата. Благодаря этому факту Р-4А можно использовать с эмалью марки ХВ-124.
  • Заменить Р-4 можно на Р-5 или на Р-5А. У них несколько шире область применения. Их можно использовать для материалов, у которых в основе каучук, кремнийорганические, полиакриловые смолы. Р-5 имеет в составе 40% толуола и по 30% бутилацетата и ацетона.
  • И также «родственником» Р-4 является растворитель Р-12. Он отличается от Р-4 тем, что в его составе нет ацетона, он заменен на ксилол. У него ниже температура воспламенения. Она составляет 490 градусов С. Р-12 надо с осторожностью применять, если для работы используются другие вещества. Дело в том, что смешиваясь с некоторыми (перекись водорода, уксусная или азотная кислота), он способен образовывать взрывоопасные смеси.

Р-12 подходит для работы с лакокрасочными материалами различного вида, с пленкообразующими веществами. Широкое применение он находит в автомастерских, где им разводят автоэмали. А также с его помощью с автомобилей снимают старую акриловую краску. Для этого краску смачивают продуктом и выжидают 10-15 минут, а затем шпателем снимают размягченный слой. Р-12 применяют в быту для чистки инструментов, удаления пятен. Следует отметить, что Р-12 агрессивен к некоторым видам пластмасс.

Растворитель Р-4 можно заменять другими марками. Здесь нужно обратить внимание на состав и технические характеристики. Если составы лакокрасочных изделий и растворителей несовместимы, то их компоненты могут свертываться либо расслаиваться. Для подбора совместимых составов лучше обратиться за советом к специалисту.

Не следует забывать, что аналоги Р-4 тоже горючие и токсичные вещества, и соблюдение мер безопасности при работе необходимо, и хранить их надо в надлежащих условиях.

Подробнее о растворителе Р-12 смотрите в видео ниже.

Ацетон, растворитель Р-646, сольвент, толуол — «Семья» растворителей. Растворитель Р-646,Р-649 и Р-650,растворитель Р-4, Р-5, Лаки и краски, эмали, морилки

Сегодня мы продолжим тему «растворители» и нашу беседу начнем со знакомства с ацетоном.

У подавляющего большинства людей ацетон ассоциируется, прежде всего, с неприятным запахом. Лучшая половина человечества, не обращая внимания на этот запах, использует ацетон для снятия лака с ногтей. Но не только запахом и способностью привести в порядок ногти прославился этот нефтепродукт. Так что же такое «ацетон»?

Ацетон, согласно словарю Брокгауза и Эфрона, представляет собой летучую, горючую, прозрачную, бесцветную жидкость, образующуюся при перегонке уксуснокислых солей. Растворяется ацетон в воде, эфире и спирте. Поясним, что эфир — это летучее вещество (соединение спиртов). Термин «спирт», как нам кажется, объяснять не надо. Брокгауз и Эфрон дали подробное определение ацетона, но промолчали о том, что его можно получить в результате брожения крахмала. А, между тем, такой способ получения ацетона является одним из самых старых. Любопытно то, что в данном способе сырьем служит кукурузная мука.

Ацетон используется в качестве растворителя эпоксидных и природных смол, масел и других материалов, а также обезжиривает поверхности. Он является одной из составляющих многих других растворителей. Наиболее популярным мы уделим особое внимание. Итак…

Растворитель Р-646, содержащий ацетон, углеводороды, эфиры и другие компоненты, является желтоватой или бесцветной жидкостью. Его используют для разбавления шпаклевок и лакокрасочных материалов (акриловых, эпоксидных, глифталевых, а также нитролаков и нитроэмалей). Растворяющее вещество Р-646 применяется для обезжиривания поверхностей и их очистки. Для придания материалам необходимой вязкости растворитель добавляют в эти материалы в небольших количествах, после чего тщательно перемешивают. В случае введения Р-646 в состав красок, поверхности, окрашенные этими красками, приобретают блеск, а растворяющее вещество испаряется, не оставляя запаха. Р-646 является токсичным, и во время работы с ним следует избегать его попадания в глаза. Помимо глаз необходимо беречь и руки. Для этого нужно использовать резиновые перчатки. Помещения, в которых применяется эта растворяющая жидкость, должны быть проветриваемыми. Хранить ее следует в закрытой емкости, на которую не попадают солнечные лучи и вдали от огня. 

Одним из близких «родственников» Р-646 является растворитель Р-647. Он используется для разбавления нитрошпаклевок и лакокрасочных материалов, содержащих в своем название буквосочетание «нитро». Как правило, применяется такое вещество в работе с лакокрасочными материалами, наносимыми на металлические поверхности. Меры предосторожности при работе с этим растворителем аналогичны мерам предосторожности, которые следует соблюдать с описанным выше Р-646, впрочем, как и со всеми растворяющими веществами, содержащими ацетон.

Р-648 применяют в работе с нитроэмалями и лаками. Его назначение — сглаживание царапин.

Р-649 и Р-650 разбавляют некоторые виды эмалей.

Р-651 — облюбовали автомастера, так как он применяется для разбавления эмалей, используемых для покраски автомобилей.

В последнее время стал пользоваться популярностью растворитель Р-4. Им разбавляют некоторые виды шпаклевок и грунтовок, а также лакокрасочные материалы. Как и подавляющее большинство своих «собратьев», Р-4 — это смесь летучих веществ. Р-4 добавляется в материал небольшими дозами и размешивается до получения нужной вязкости. Этот растворитель способствует образованию блестящей пленки, а во время высыхания (к радости окружающих) «теряет» свой запах.

Что касается мер предосторожности в работе с Р-4, то они ничем не отличаются от тех мер, о которых говорилось выше.

«Ближайшим родственником» Р-4 является растворитель Р-5. Его используют для разбавления лакокрасочных материалов (лаков, эмалей) на основе смол. Р-5 содержит в своем составе ацетон, о котором мы еще вспомним, когда будем говорить о клеях. Сейчас же мы продолжим беседу о растворителях и познакомимся еще с одним из их представителей — сольвентом.

Этот растворитель представляет собой бесцветную или светло-желтую прозрачную жидкость. Область применения этого вспомогательного материала достаточно обширна, но нас, в первую очередь, интересует его участие в деле строительства и ремонта.

В состав сольвента входят парафины, нафтены — углеводороды, содержащиеся в нефти, а также другие углеводороды. Сольвент — это результат процесса коксования каменного угля. Сольвент образуется и при пиролизе — необратимом термическом процессе разложения веществ. На этом урок химии можно закончить. Этот «продукт» бывает каменноугольным и нефтяным. Оба варианта сольвента используется в качестве растворителя лакокрасочных материалов, а также для обезжиривания поверхностей. В составе сольвента отсутствуют механические примеси и вода. Этот растворитель является легковоспламеняющимся, поэтому при работе с ним следует соблюдать повышенные меры предосторожности.

Еще одним растворителем является толуол. Емкости, содержащие такое вещество, не встретишь на прилавках, но, тем не менее, мы скажем о нем несколько слов. Так же, как и сольвент, толуол не содержит воду и примеси. Представляет он собой прозрачную жидкость, но, несмотря на свой безобидный вид, достаточно токсичен, а действие его паров приравнивается к действию наркотиков. К тому же, при взаимодействии с воздухом эти пары могут образовать взрывоопасную смесь. Этот материал пожароопасен. Применяется толуол для растворения некоторых видов алкидов и смол. Он является одним из компонентов многих растворяющих смесей. Для чего мы говорим о толуоле? Надо сказать, что не все растворители следует использовать для разбавления лакокрасочных материалов при проведении малярных и отделочных работ. При желании можно приобрести любой нефтепродукт, но стоит ли рисковать? Многие растворители, такие как толуол, используются в качестве компонентов при производстве других растворяющих веществ. Поэтому, если вы не являетесь обладателем химического завода, то выбирайте растворитель, предназначенный для применения в домашних условиях.

В следующий раз мы поговорим о разбавителях.

Алексей Каверау

В статье использованы фотографии: сайтов ustroy, lik, ahzvika, Компании «Дизар», ООО «Химабсолют»

Инструменты и методы выбора растворителя: руководства по выбору зеленого растворителя | Устойчивые химические процессы

Растворителям уделяется большое внимание в рамках «зеленой» химии [1–5]. Это можно объяснить большим объемом растворителя, обычно используемого в реакции (особенно на стадии очистки) или в рецептуре [6, 7]. Несмотря на это, растворитель не отвечает непосредственно за состав продукта реакции и не является активным компонентом препарата.Следовательно, использование токсичных, легковоспламеняющихся или вредных для окружающей среды растворителей представляется ненужным, поскольку эти характеристики не влияют на функционирование или развитие системы, в которой применяется растворитель. Однако эти неблагоприятные последствия использования растворителя часто связаны с полезными свойствами растворителя, необходимого для применения. Летучесть растворителей позволяет извлекать и очищать растворитель путем перегонки, но также создает нежелательные выбросы в атмосферу и риск воздействия на рабочих.Амидные растворители обладают высокой полярностью, необходимой для растворения широкого спектра субстратов и ускорения реакций [8], но эта функциональность часто подразумевает репродуктивную токсичность [9]. На другом конце шкалы полярности углеводородные растворители обеспечивают способность растворять масла при экстракции и разделении [10, 11], но в то же время они легко воспламеняются, а их низкая растворимость в воде (высокий logP) связана с биоаккумуляцией. и водная токсичность [12, 13].

В попытках устранить нежелательные растворители стратегии замены часто направлены на структурно родственные соединения, еще не охваченные законодательными и нормативными мерами, обычно требуемыми для принятия мер в этом отношении.Так, бензол, с момента его официального признания канцерогеном в середине ХХ века, обычно заменяют толуолом [14, 15]. Точно так же Монреальский протокол ограничивает использование тетрахлорметана с 1989 года из-за его роли в разрушении озонового слоя [16, 17]. Обычно вместо них теперь используются галогенированные растворители хлороформ и дихлорметан (ДХМ). Важно подчеркнуть, что эти меры оказались недальновидными по сравнению со все более строгим химическим контролем во всем мире. Толуол фактически подозревается в повреждении неродившегося ребенка и в повреждении органов при длительном воздействии [18, 19]. Согласно оценкам IARC Всемирной организации здравоохранения, хлороформ и ДХМ могут быть канцерогенными для человека [15]. Кроме того, теперь было показано, что ДХМ, даже будучи короткоживущим галогенированным веществом, также разрушает озоновый слой [20].

Европейский регламент, касающийся «Регистрации, оценки, авторизации и ограничения химических веществ» (REACH), ввел ограничения на толуол, хлороформ и ДХМ с особыми условиями (таблица 1) [21–23].REACH в настоящее время влияет на импорт и использование широкого спектра химических веществ в Европе. Любые продукты, не соответствующие условиям, установленным в REACH, удаляются с рынка через информационную схему «система быстрого оповещения об опасных непищевых продуктах» (RAPEX) [24]. Возьмем лишь небольшую выборку: в 2015 г. к запрещенным продуктам относились клеи, содержащие толуол [25], хлороформ [26] или бензол [27], а иногда и в угрожающе значительных количествах [28].

Таблица 1 Ограничения REACH для растворителей толуола, дихлорметана и хлороформа с указанием кодов опасности [21–23]

В преддверии будущих европейских запретов на растворители химические вещества-кандидаты помещаются в список «веществ, вызывающих очень большую озабоченность» (SVHC) до введения ограничений REACH [30].В частности, для пользователей растворителей амиды N , N -диметилформамид (ДМФ), N , N -диметилацетамид (DMAc) и N -метилпирролидинон (NMP), а также некоторые гидроксиэфиры и хлорированные растворители попали под пристальное внимание (таблица 2). Растворители со сходной структурой могут быть легко получены в качестве заменителей, но они, вероятно, будут представлять многие из тех же проблем в области охраны окружающей среды, здоровья и безопасности (EHS), которые наблюдались в исторических примерах замещения растворителей.Агентства по охране окружающей среды в других регионах имеют свои собственные подходы к регулированию опасных химических веществ, причем растворители подвергаются сильному воздействию из-за их статуса ЛОС и, следовательно, высокого риска воздействия [31].

Таблица 2 Неполный список растворителей, включенных в список кандидатов REACH для SVHC [30]

В попытке классифицировать растворители в соответствии с их профилями EHS были выпущены руководства по выбору растворителей, дающие больше информации, чем «черно-белые» заключения нормативных оценок.В рамках этого обзора рассматривается замена обычных органических растворителей более экологичными органическими растворителями, в идеале на биологической основе, с помощью инструментов выбора растворителя. Разработка более сложных подходов к замещению растворителя, которые также учитывают характеристики растворителя, или разработка растворителей, изготовленных по индивидуальному заказу, также будут упоминаться, но не составляют основу серьезного обсуждения в настоящей работе.

Определение экологически чистых растворителей

Вопрос, поставленный Фишером и его сотрудниками из ETH Zurich (также известного как Швейцарский федеральный технологический институт) в названии их статьи 2007 года, является фундаментальным; «что такое зеленый растворитель» [32]? Их ответ — теперь влиятельная двухуровневая оценка окружающей среды, здоровья и безопасности (EHS) и потребности в энергии (которую можно рассматривать как быстрый расчет типа LCA). Зная энергию, необходимую для производства растворителя, и варианты, доступные в конце срока службы для восстановления части этой энергии, можно рассчитать чистую совокупную потребность в энергии (CED) производства растворителя. Регенерация энергии может быть достигнута путем сжигания или путем компенсации потребности в ресурсах путем повторного использования растворителя. Очистка отработанного растворителя перегонкой менее энергозатратна, чем производство эквивалентного объема нового растворителя. Сжигание напрямую производит энергию, но вместо него требуется больше растворителя.

Подход, обеспечивающий большее снижение КЭД, зависит от типа растворителя (рис. 1). На рис. 1 энергия, необходимая для производства 1 кг растворителя, показана в виде полос с синей сплошной заливкой. Энергия, необходимая для перегонки растворителя, а не для его производства, показана красными полосками. Сэкономленная энергия (кредит дистилляции) показана внизу. Кредит сжигания — это рекуперация энергии от сжигания, в результате чего снижается CED, как показано зелеными пунктирными полосами. Большинство (но не все) углеводородов лучше всего сжигать в соответствии с этим упрощенным подходом ОЖЦ (например,г., n -гексан, но не толуол). То же самое относится и к диэтиловому эфиру. Функционализированные растворители с более длинными производственными путями лучше всего перерабатывать, чтобы сохранить энергию и ценность, вложенные в молекулу во время ее первоначального синтеза (например, ДМФА). Для этанола преимущества довольно близко сбалансированы. Еще более подробная оценка потребности в энергии при производстве растворителей была опубликована теми же авторами [33].

Рис. 1

Потребность в энергии, связанная с производством пяти репрезентативных растворителей

Инструмент EHS, являющийся партнером оценки CED, предоставляется бесплатно в виде простой в использовании электронной таблицы (.xls) файл [34]. Методология полностью раскрыта (рис. 2), поэтому при наличии необходимых данных ее можно применять к любому растворителю и любым комбинациям растворителей, используемых в процессе. Рейтинг основан на кодах опасности и риска, а также на установленных законом ограничениях воздействия. Поэтому всеобъемлющего паспорта безопасности должно быть достаточно, чтобы оценить экологичность растворителя с использованием этого подхода. Действительно, это было предпринято для летучих метилсилоксановых растворителей в отдельной работе [35]. Однако с 2008 г. и введением Глобальной гармонизированной системы (СГС) в соответствии с положениями Европейской классификации, маркировки и упаковки (CLP) [29] этот метод нуждается в пересмотре.

Рис. 2

Пример шкалы классификации растворителей ETH Zurich (категория пожаро-взрывоопасности)

Три критерия в трех категориях EHS объединены в числовую систему ранжирования. Более низкие оценки указывают на более экологичные растворители (рис. 3). Как правило, результаты соответствуют интуитивным ожиданиям: спирты и сложные эфиры воспринимаются как более экологичные, чем углеводороды, которые, в свою очередь, имеют лучшие оценки, чем формальдегид (5,6) и 1,4-диоксан (5,0). Равный вес вопросов окружающей среды, здоровья и безопасности может быть предметом обсуждения для репротоксичного ДМФА (3.7) регистрируется как более зеленый, чем пероксидобразующие эфирные растворители, такие как диэтиловый эфир (3.9).

Рис. 3

Оценка состояния окружающей среды и безопасности для пяти репрезентативных растворителей

Сочетание энергопотребления с оценкой растворителей по EHS позволяет получить более полную картину воздействия растворителей. Метилацетат и спиртовые растворители обеспечивают оптимальный баланс низкого энергопотребления и благоприятного профиля EHS (рис. 4). Другая полезная информация, которая появляется, включает очень большую потребность в энергии для производства тетрагидрофурана (ТГФ).При 270 МДж/кг, хотя впоследствии в следующей публикации [33] этот показатель был снижен ближе к 170 МДж/кг, рекомендуется перегонка ТГФ для снижения общего КЭД всего до 40,1 МДж/кг. И наоборот, диэтиловый эфир (с его более низким CED) лучше всего сжигать, чтобы свести к минимуму чистое потребление энергии. Последствия сжигания, связанные с выбросами в атмосферу, выходят за рамки этой оценки, но их следует учитывать на практике, особенно для растворителей, содержащих азот и серу, которые приводят к выбросам NO x и SO x при сжигании [36, 37].

Рис. 4

Карта значений EHS и CED для репрезентативных растворителей

В том же духе Слейтер и Савелски из Университета Роуэна также разработали средства для сравнения различных растворителей, доступных для процесса [38]. Они также создали электронную таблицу, которую может свободно использовать каждый [39]. Для каждого растворителя был разработан индекс, состоящий из 12 параметров окружающей среды, в том числе соображений гигиены труда (острая токсичность, биоразложение, потенциал глобального потепления и т. д.).). Соображения безопасности, такие как температура вспышки и образование перекиси, не используются в качестве параметров выбора растворителя. Это решение может быть воспринято как недосмотр, по крайней мере, это отклонение от подхода EHS ETH Zurich. Суммирование параметров (соответственно масштабированных с заданным пользователем взвешиванием) дает оценку от 0 (наиболее зеленый) до 10 (наименее зеленый). Принимая во внимание количество используемого растворителя, можно сравнивать процессы для оценки наименьшего воздействия растворителя. Этот подход Университета Роуэна был использован для оценки путей получения силденафила цитрата (активного ингредиента Виагры™), показывая, как их «общий индекс экологичности» уменьшился в 400 раз по сравнению с исходным процессом медицинской химии до новейшего коммерческого пути.

На основе этой методологии была также создана таблица выбора растворителей, содержащая более 60 растворителей [39]. Единственным соображением хронической токсичности является канцерогенность, поэтому репротоксичные растворители, такие как NMP, имеют более высокую воспринимаемую зеленость (т.е. 3,0 из 10,0), чем можно было бы ожидать (например, 1-бутанол имеет оценку 4,6). Как показано на конкретном примере углеводородных растворителей, подход Университета Роуэна предлагает лучшую дифференциацию между растворителями по сравнению с инструментом ETH Zurich (рис.5). На рис. 5 шкалы оценок степени зеленого растворителя ETH Zurich (слева, 0–9) и Университета Роуэна (справа, 0–10) представлены таким образом, что баллы для этанола равны по величине, а не приравнять две зависимые переменные. Этанол включен в качестве эталона, поскольку обе системы согласны с тем, что это экологически чистый растворитель (этанол не предлагается в качестве альтернативы любому углеводородному растворителю). В то время как подход, разработанный Швейцарской высшей технической школой Цюриха, не позволяет провести какое-либо значимое различие между степенью зелени углеводородов, оценка Университета Роуэна предлагает большую дисперсию в этом наборе.Соответственно циклогексан и н -гептан считаются более зелеными, чем н -пентан и н -гексан, а зеленость ароматических растворителей увеличивается при замещении метильной группы.

Рис. 5

Зеленость обычных углеводородных растворителей по отношению к этанолу

Выбор растворителей для исследовательской химии

Общая концепция создания рейтингов экологичности растворителей в химической промышленности приняла другое направление.Фармацевтический сектор, в частности, стремился установить свои собственные институциональные иерархии экологичности растворителя с момента осознания того, что растворитель является основным компонентом типичной реакции при производстве активного фармацевтического ингредиента [7]. Как следствие, технологические растворители ответственны за большую часть использования энергии, отходов и выбросов парниковых газов [40]. Это делает минимизацию использования растворителей и более экологичные замены приоритетом и часто становится легкой целью в инициативах по «зеленой» химии [41].Хотя химия без растворителей всегда представляла интерес для «зеленых» химиков [42, 43], в целом она не применима к синтезу фармацевтических препаратов и других тонких химикатов. Растворитель может оказывать сильное влияние на скорость реакции и селективность продукта [44], и нельзя упускать из виду более общие преимущества использования растворителя в реакциях. Растворители действуют как поглотитель тепла и регулятор температуры, снижают вязкость смеси и улучшают массоперенос, делают возможным селективную экстракцию и разделение [31, 45].

Средства выбора растворителя не всегда требуют от пользователя выполнения расчетов и сравнения числовых систем ранжирования. Альтернативные растворители с низкой токсичностью, минимальными проблемами безопасности и незначительным воздействием на окружающую среду могут быть выбраны из простых наглядных пособий [46–48]. Для этой цели теперь доступны даже приложения для мобильных телефонов [49]. Руководства по выбору растворителей, разработанные для небольших химических лабораторий фармацевтической промышленности, как правило, представляют собой списки растворителей, составленные в соответствии с политикой использования компании. По сравнению с инструментами ETH Zurich и Rowan University существует более четкая корреляция между растворителями, ограниченными правилами (таблицы 1, 2), и рекомендациями руководств по выбору растворителей для фармацевтической промышленности. В этой работе для сравнения были объединены три известных руководства, разработанных для медицинской химии (рис. 6, 7). Цветовое кодирование — это универсально используемая система «светофора» с комментариями по каждому растворителю, характерными для условий, установленных каждой компанией.Поэтому там, где Pfizer может считать растворитель «пригодным для использования», GSK заявляет, что у него есть «некоторые проблемы», а Sanofi предлагает «рекомендуется замена» (например, в случае с толуолом). Рисунки 6 и 7 сокращены, чтобы включать только растворители, по крайней мере, с двумя записями в руководствах по выбору растворителей для медицинской химии Pfizer, GSK и Sanofi. Расширенная версия, содержащая все растворители, представленные в трех инструментах, представлена ​​в виде дополнительного файла (Дополнительный файл 1).

Рис. 6

Унифицированная версия общих руководств по выбору растворителей для медицинских химиков (часть 1) [46–48]

Рис.7

Унифицированная версия общих руководств по выбору растворителей для медицинских химиков (часть 2) [46–48]

Pfizer была первой компанией, опубликовавшей свое цветовое иерархическое руководство по выбору растворителей для медицинских химиков [48]. Инструмент представляет собой простой документ, в котором растворители перечислены как «предпочтительные», «пригодные» или «нежелательные» (см. рис. 6, 7; дополнительный файл 1). Pfizer уделяет первостепенное внимание удобству использования при создании этого руководства по выбору растворителя, хотя бы для того, чтобы побудить химиков использовать его.В результате можно считать, что этот инструмент является ограниченным и неавантюрным, но, продвигая небольшие изменения, которые немногие сочтут разрушительными для своей работы, можно ощутить большую выгоду для всей компании. В качестве дополнения к руководству по выбору растворителя Pfizer предоставляется полезное руководство по замене тех растворителей, которые считаются нежелательными (таблица 3). В этом сопроводительном документе они предлагают ДХМ в качестве замены другим хлорированным растворителям в случаях, когда неприменим нехлорированный растворитель.Хотя это ни в коем случае не идеальный вывод, внедряя этот инструмент в свои лаборатории медицинской химии, компания Pfizer фактически сообщила о сокращении использования хлорированных растворителей на 50 % в течение 2 лет и добилась сокращения нежелательных эфиров на 97 % (особенно диизопропилового эфира). Они также наблюдали увеличение использования n -гептана вместо нейротоксичного n -гексана и более летучего и легковоспламеняющегося n -пентана. Таким образом, можно сделать вывод, что, просто повышая осведомленность о проблемах с растворителями, руководство может направить химиков-лаборантов на более экологичное использование растворителей с помощью простейших средств выбора растворителя.

Таблица 3 Таблица замены растворителей Pfizer [48]

GlaxoSmithKline (GSK) уже выпускала руководства по выбору растворителей для химиков-технологов к тому времени, когда был опубликован инструмент Pfizer для медицинской химии [37, 40]. Затем GSK последовала этому примеру, выпустив упрощенное руководство по выбору растворителя для лабораторий медицинской химии, основанное на обновленной и расширенной оценке растворителя [46]. Эта методология более многогранна, чем инструмент Pfizer, с подробной разбивкой баллов по различным категориям EHS, которые бесплатно доступны в качестве дополнительной информации к основной статье [50].Одно заметное различие между рейтингами зеленого цвета растворителя Pfizer и GSK касается метилэтилкетона (МЭК), который предпочтительнее, чем Pfizer, но считается, что он имеет серьезные проблемы для GSK (рис. 7). Чтобы уточнить, MEK действительно имеет серьезные экологические последствия [51], но безопасен в обращении с низкой токсичностью [46]. Контраст между его свойствами EHS, вероятно, является причиной различных интерпретаций двух руководств по выбору растворителя, при этом инструмент Pfizer больше ориентирован на здоровье и безопасность.Данные, лежащие в основе руководства GSK по выбору растворителя для медицинской химии, также используются учеными, занимающимися разработкой процессов, и, соответственно, включают больше параметров окружающей среды.

Совсем недавно Санофи также предложила эквивалентное руководство по выбору растворителя [47]. Инструмент разработан на основе ранней версии внутреннего руководства компании по выбору растворителей, в котором растворители были разделены на рекомендуемый список и список заменителей. Химики, разрабатывающие синтетические методы, должны были оправдать использование растворителей из списка заменителей, доказав, что никакие альтернативы не работают так же эффективно.Однако список замен был очень длинным и громоздким, как сообщают авторы [47]. Поэтому был разработан новый инструмент, предоставляющий справочную карту для каждого растворителя, содержащую полезные данные о свойствах. Таблица выбора растворителей для каждого класса растворителей с общими рекомендациями для каждого растворителя дополнена их ожидаемыми ограничениями и соответствующими предупреждениями об опасности. В руководстве по выбору растворителей Sanofi содержится гораздо больше растворителей, чем в инструментах медицинской химии Pfizer и GSK.Общий вывод для каждого растворителя был дан ранее на рис. 6 и 7 (расширенную версию см. в Дополнительном файле 1). Следующий сокращенный набор данных только по диполярным апротонным растворителям демонстрирует детали руководства по выбору растворителя Санофи (рис. 8). Используется знакомая цветовая кодировка светофора с дополнительными индикаторами. Используются предельные значения остаточного растворителя для фармацевтических препаратов, установленные Международной конференцией по гармонизации (ICH) [52].

Рис.8

Руководство по выбору растворителей Санофи для выбранных диполярных апротонных растворителей

Использование законодательных категорий делает руководство Санофи по выбору растворителя актуальным для промышленности, руководствуясь необходимостью, а не любым личным восприятием того, что на самом деле представляет собой зеленый растворитель. Общий рейтинг и список других проблем делают инструмент полезным для пользователей в лабораториях исследовательской химии, которые могут не сталкиваться напрямую с нормативными ограничениями использования растворителей.Для амидных растворителей на рис. 8 требуется замена ацетонитрила в качестве единственного рекомендуемого растворителя, который можно использовать вместо него. Отсутствие вариантов для зеленых диполярных апротонов очевидно, даже ацетонитрил не рассматривается в качестве зеленого растворителя в других руководствах по выбору растворителя [46, 48]. Для более высокотемпературных реакций приемлемыми вариантами могут быть диметилсульфоксид (ДМСО) и сульфолан, хотя рекомендуется их замена.

Сопоставление данных из руководств по выбору растворителей Pfizer, GSK и Sanofi позволяет сделать ряд выводов.Наиболее зелеными растворителями (т. е. с тремя заштрихованными зелеными элементами или двумя зелеными элементами и пустой записью на рисунках 6 и 7) являются вода, n -пропилацетат, i -пропилацетат, 1-бутанол и 2- бутанол. Этот набор строго ограничен: только спирты и сложные эфиры, содержащиеся наряду с водой, повсеместно признаны зелеными растворителями. Этот вывод согласуется с инструментами ETH Zurich и Rowan University. Также можно сделать выводы относительно наименее желательных растворителей.Следующие растворители однозначно считаются нежелательными, если они еще не запрещены (т. е. по крайней мере две позиции, заштрихованные красным или черным цветом на рисунках 6 и 7, без желтых или зеленых записей): хлороформ, 1,2-ДХЭ, четыреххлористый углерод, NMP, ДМФА, ДМАА, бензол, гексан, 1,4-диоксан, 1,2-ДМЭ, диэтиловый эфир и 2-метоксиэтанол. Этот набор исключает многие диполярные апротонные, хлорированные, углеводородные и эфирные растворители. Химики должны быть осторожны при использовании этих типов растворителей и учитывать последствия их выбора для EHS.В этом отношении 2-метилтетрагидрофуран (2-MeTHF) и -трет--бутилметиловый эфир (TBME) предпочтительнее ТГФ и диэтилового эфира. Если в классе растворителей нет «зеленых» вариантов, ясно, что только при необычных обстоятельствах один из «зеленых» растворителей, упомянутых выше, может заменить растворители из красного или черного списка без существенной перестройки процесса. В качестве дополнительного усложнения три руководства по выбору растворителя, показанные на рис. 6 и 7 не всегда совпадают. Например, ацетонитрил дает разные результаты в каждом из руководств по выбору растворителя.

Оценка растворителей для экологически чистой химии

Простой трехуровневый подход с цветовой кодировкой к классификации растворителей для целей медицинской химии имеет то преимущество, что его легко интерпретировать, но за счет ограничения глубины предоставляемой информации. При разработке крупномасштабных реакций требуется больше информации о каждом растворителе, поскольку процесс ориентирован на производство в промышленных масштабах, где любые проблемы, связанные с EHS, усиливаются. GlaxoSmithKline (GSK) была первой фармацевтической компанией, опубликовавшей руководство по выбору растворителя, предназначенное для использования в процессе разработки [37, 40].В своем первоначальном представлении каждый из 35 представленных растворителей имеет относительный рейтинг от 1 (незеленый) до 10 (зеленый) в четырех категориях отходов, воздействия на окружающую среду, здоровья и безопасности [37]. В каждой категории учитывается ряд параметров. Например, категория отходов включает сжигание, регенерацию растворителей и биологическую обработку отходов. Свойства растворителя, влияющие на сжигание, включают его теплоту сгорания, возможность образования HCl или диоксина или выбросы NO X и SO X , а также его растворимость в воде (рис.9). Полный список категорий представлен в прилагаемом дополнительном файле (Дополнительный файл 1). Позднее этот подход был расширен и теперь включает пятую категорию по оценке жизненного цикла [40].

Рис. 9

Некоторые свойства, определяющие показатель отходов растворителей в руководствах GSK по выбору растворителей [37, 40]

После публикации своего руководства по выбору растворителей для медицинской химии GSK добавила новый показатель реактивности/стабильности и законодательные флаги, чтобы указать, где существуют средства контроля для использования растворителей [46]. Сильно сокращенная версия последней классификации GSK представлена ​​на рис. 10, на которой перечислены только диполярные апротонные растворители в качестве примера класса растворителей, который трудно заменить. Категории: отходы, воздействие на окружающую среду, здоровье, воспламеняемость, реактивность и оценка жизненного цикла (LCA). Законодательные меры контроля также обозначены в виде «флажков» на рис. 10. Система подсчета очков подчеркивает безопасность использования, но токсичность диполярных апротонных растворителей. Из-за контраста между отдельными показателями такое представление данных более полезно, чем один индикатор EHS.В этом случае подходы ETH Zurich и Rowan University могут дать вводящую в заблуждение «среднюю» оценку. Большая детализация отдельных баллов также устраняет неоднозначность трехуровневых оценок с цветовой кодировкой, представленных на рис. 6 и 7.

Рис. 10

Выдержка из руководства по выбору растворителя GSK (диполярные апротонные растворители)

Решения, принимаемые с помощью инструментов GSK, не являются непреложными вердиктами, они динамичны и меняются перед лицом новой информации и меняющейся политики компании. Действительно, баллы, приписываемые каждому растворителю, менялись со временем [53]. В подходе, используемом GSK, используется среднее геометрическое значений свойств, составляющих каждую категорию, для установления числовой шкалы для каждой оценки EHS. Нижний предел и верхний предел определены таким образом, чтобы шкала от 1 до 10 не растягивалась слишком далеко за счет выбросов, которые могли бы скопить большинство растворителей в середине шкалы (рис. 11) [40]. Это означает, что баллы EHS зависят от того, какие растворители включены в оценку, что может быть преднамеренно созданным смещением и будет меняться по мере добавления новых растворителей.Преимущество этого расчета заключается в том, что окончательная оценка в противном случае не является субъективной, и получен полезный разброс оценок от 1 до 10.

Рис.

Концепция предоставления числовых оценок для профиля EHS растворителей оказалась популярной и впоследствии была повторена другими учреждениями. Фармацевтический круглый стол Института зеленой химии (GCI) Американского химического общества (ACS) был инициирован в 2005 году и объединил 14 партнерских организаций с целью установления общих целей и стандартов в отношении практики зеленой химии.Вместе они разработали руководство по выбору растворителя [54], используя знакомую числовую оценку и цветовую кодировку из руководства по выбору растворителя GSK и неопубликованного эквивалента AstraZeneca [55]. Оно также было преобразовано в приложение для мобильных телефонов [49]. В руководстве по выбору растворителя ACS GCI есть одна категория здоровья и одна категория безопасности, которые сопровождаются тремя экологическими критериями. Оценка для диполярных апротонных растворителей представлена ​​на рис. 12, что обеспечивает сравнение с более ранними таблицами выбора растворителей (рис.8, 10). Обратите внимание, что оценка обратная по сравнению с инструментом GSK. Тем не менее, распределение цветового кодирования одинаковое: три наихудших возможных результата (8, 9 и 10) заштрихованы красным, а идеальные баллы (1, 2 и 3) — зеленым. Остальные опции окрашены в желтый цвет. Проверка полного руководства ACS GCI показывает, что в целом очень мало красных (т.е. незеленых) оценок [54], этот факт также повторяется на рис. 12. Серосодержащие растворители штрафуются за выбросы SO X , образующиеся при сжигании.Несколько эфирных растворителей имеют низкие показатели безопасности или здоровья, но по большей части этот инструмент можно считать более щадящим, чем, например, руководство по выбору растворителя GSK. Например, оценка состояния здоровья, по-видимому, не включает хроническую токсичность, что вызывает беспокойство в отношении NMP, DMF и DMAc (таблица 2). Отсутствие информации о заданиях, приведенных в руководстве по выбору растворителя ACS GCI, действительно вызывает вопросы, но это общая проблема, которая полностью устраняется только интерактивными инструментами, разработанными ETH Zurich и Rowan University, которые сами по себе также искажают распространенные амидные растворители DMF. , DMAc и NMP в качестве зеленых растворителей.

Рис. 12

Выдержка из руководства по выбору растворителя ACS GCI (диполярные апротонные растворители)

Можно возразить, что многие категории инструментов GSK и ACS GCI, каждая из которых имеет числовую шкалу, полученную из различных параметров, слишком затрудняют балансировку этих различных аспектов и достижение твердого вывода. Пороговые значения, определяющие различные оценки с цветовой кодировкой, устанавливаются в соответствии с предпочтениями разработчиков руководства и могут не соответствовать инструментам или регламентам.Ответ на это представлен в более поздней попытке разработать руководство по выбору растворителя с большим акцентом на нормативный контроль. Этот инструмент был создан учеными из Sanofi, GSK, Pfizer, Йоркского университета и консультантами Charnwood в рамках совместного исследовательского проекта, известного как CHEM21, государственно-частного партнерства в рамках инициативы по инновационным лекарствам (IMI) [56]. . Подход, используемый для определения зеленого цвета растворителя, во многом основан на Глобальной согласованной системе (СГС) классификации, маркировки и упаковки (CLP) веществ [29].Методология находится в открытом доступе в качестве дополнительной информации к статье и может использоваться по желанию для расширения и адаптации оценки к новым растворителям. Таким образом, эта недавняя разработка демонстрирует четкую эволюцию инструмента ETH Zurich, снова основанного на кодах опасности и физических свойствах растворителей, но обновленного в соответствии с самыми последними химическими нормами. Ключевое отличие заключается в том, что окончательный рейтинг каждого растворителя в справочнике CHEM21 основан на его наименее зеленой характеристике, а не на среднем значении или сумме несвязанных свойств.Шкала имеет верхний предел в десять баллов как худшую оценку, но в отличие от предыдущих инструментов оценка семь теперь заштрихована красным. Кроме того, с каждым растворителем связана фраза, как в случае с упрощенными руководствами по выбору растворителя для медицинской химии от Pfizer, Sanofi и GSK. Это означает, что для его использования не всегда требуется детальное изучение инструмента. Однако полезность и точность этого обобщающего утверждения сомнительны, учитывая, что ответственный проектный консорциум иногда отменял методологию, основанную на данных.Это видно для ацетонитрила и ДМСО в следующем отрывке только для диполярных апротонных растворителей (рис. 13). Это подчеркивает, что выбор растворителя никогда не может быть точной наукой, и предпочтения организации в отношении определенных растворителей будут влиять на каждое обозначение, точно так же, как прошлый опыт химика с растворителями исторически определял их собственный выбор растворителя на личной основе. Тем не менее, благодаря руководству по выбору растворителя, основанному на опыте и нормативных актах, этот инструмент может согласовать использование растворителя с ожидаемыми мерами контроля и ограничениями на использование опасных химических веществ в будущем, облегчая переход на более экологичное использование растворителя. Также обратите внимание, что показатели здоровья для амидных растворителей более репрезентативны для их репротоксичности, чем приведенные в руководстве по выбору растворителей ACS GCI.

Рис. 13

Выдержка из руководства по выбору растворителя CHEM21 (обычный) (только для биполярных апротонных растворителей)

Члены консорциума CHEM21 по отдельности рассмотрели выводы трех руководств по выбору растворителей (GSK, AstraZeneca, ACS GCI) в попытке прийти к единому мнению, которое впоследствии легло в основу разработки их собственного руководства, рассмотренного выше [57].Каждый инструмент был адаптирован для трехуровневой оценки воздействия на безопасность, здоровье и окружающую среду. В этой работе результаты обзора руководств по выбору растворителей CHEM21 дополняются руководствами по выбору растворителей Sanofi и более новыми CHEM21. Всего пять инструментов могут быть организованы в соответствии с форматом тройной категории EHS, завершающейся общей оценкой. На рис. 14 цветовые оттенки основаны на оттенках исходных публикаций, а числа удалены, поскольку шкалы не зависят друг от друга.Результаты категорий безопасности (S), здоровья (H) и окружающей среды (E), а также общий вывод были присвоены в соответствии с методологией исследования CHEM21 в случае руководств GSK, AstraZeneca и ACS GCI [57]. ]. Зеленые (G), желтые (Y) и красные (R) элементы на рис. 14 помечены соответствующим образом. Это означает, что конфликты между исходными инструментами и согласованными результатами обследования действительно возникают. Например, ацетонитрил в настоящее время признан проблематичным (желтая категория) в соответствии с руководством GSK и в целом.Однако в оригинальном руководстве GSK по выбору растворителя ацетонитрил был отмечен красным цветом, и считалось, что он имеет серьезные проблемы. Информацию из оригинальных руководств по выбору растворителей Sanofi и CHEM21 можно использовать напрямую, поскольку оба эти инструмента представляют собой тройную оценку EHS с общим выводом для каждого растворителя в любом случае. В случае руководства по выбору растворителей Санофи в первую очередь использовалась оценка гигиены труда. Если данные недоступны, для категории здоровья использовался предел концентрации ICH.Любые пересмотренные выводы в инструменте CHEM21 отображаются справа от заключения по умолчанию. Здесь сравниваются только диполярные апротонные растворители (рис. 14), но полная таблица представлена ​​в виде дополнительного файла (Дополнительный файл 1).

Рис. 14

Упрощенный рейтинг окружающей среды (E), здоровья (H) и безопасности (S) для диполярных апротонных растворителей [54, 56, 57]

Интерпретируя рис. 14, снова становится очевидным, что NMP, DMF и DMAc не являются желательными растворителями.Инструменты, разработанные AstraZeneca и ACS GCI, менее суровы в своей оценке, но неясно, почему, учитывая репродуктивную токсичность амидных растворителей. Метод преобразования оценок AstraZeneca для обзора руководств по выбору растворителя оценивает NMP как более экологичный, чем этилацетат [57]. Это ясно указывает на несоответствие между подходом AstraZeneca к выбору растворителя и известными опасениями по поводу хронической токсичности, особенно в связи с тем, что NMP является веществом, вызывающим очень большие опасения, что связано с ограничениями на его использование в Европе [30].Несмотря на проблемы со стабильностью при высоких температурах, ДМСО кажется более экологичной альтернативой. Сульфолан также ранее считался лучшим растворителем по сравнению с репротоксичными диполярными апротонными растворителями [58]. Sulpholane получает три балла зеленого цвета от Sanofi в своей оценке EHS, но получает только общий желтый рейтинг, что означает «рекомендуется замена». Это связано с тем, что он имеет предел концентрации ICH от умеренного до низкого в фармацевтических препаратах (160 частей на миллион) и дополнительно наказывается за его высокую температуру плавления и высокую температуру кипения [47].Общий сульфолан рекомендуется в качестве растворителя в обзоре руководств по выбору растворителя. К сожалению, в настоящее время предполагается, что сульфолан также является репротоксином, и этот факт отражен в выводах руководства по выбору растворителя CHEM21 (рис. 13) [56]. Эта информация содержится только в самых последних паспортах безопасности, и на момент написания она не была широко известна [59]. Несмотря на то, что производное мочевины диметилпропиленмочевина (ДМПУ) было рекомендовано в качестве альтернативного растворителя за десятилетия до того, как появились руководства по выбору растворителя в фармацевтической промышленности, оно не стало известным «зеленым» растворителем, но его также стоит рассмотреть для определенных типов химии [60, 61].

Результаты обзора руководств по выбору растворителей, проведенного консорциумом CHEM21, были использованы для составления сводки (таблица 4) [57]. Консенсус в классификации растворителей не всегда был найден [57], поэтому были введены промежуточные категории «рекомендуемые или проблематичные» и «проблемные или опасные». Неубедительное положение некоторых растворителей в этой иерархии связано с различными интерпретациями того, что значит быть зеленым. В целом обзор был весьма успешным в определении набора идеальных растворителей.Разнообразие самых экологичных растворителей явно ограничено, что подчеркивает необходимость разработки новых растворителей для замены амидов, хлорированных растворителей и особенно углеводородов. Одной из возможных зеленых альтернатив амидным растворителям является сульфолан, но, как обсуждалось ранее, более поздние оценки менее одобрительны (рис. 13) [56].

Таблица 4 Общий рейтинг растворителей с использованием руководств по выбору растворителей от GSK, AstraZeneca и ACS GCI [57]

Отсутствие широты существующего каталога экологически чистых растворителей подтверждается еще одной недавней попыткой обобщить различные руководства по выбору растворителей [53].Здесь зеленым обозначены только некоторые кислоты, спирты, сложные и простые эфиры (и сульфолан). Методология оценки Eastman et al. основан на руководствах по выбору растворителей GSK, Pfizer и Sanofi, но никакой дополнительной информации предоставлено не было, и поэтому он не рассматривается подробно в рамках данной работы [53].

Источники растворителей

Ключевым вопросом, явно отсутствующим почти во всех руководствах по выбору растворителей, является происхождение каждого растворителя. Инструмент ETH Zurich для расчета КЭД производства растворителя напрямую решает эту проблему [32], но ограничивается обычными нефтехимическими растворителями [33].Обзоры по теме растворителей на биологической основе см. в следующих ссылках [4, 62–64]. Для обеспечения устойчивости химической промышленности необходимо использовать возобновляемое сырье [5]. Руководства по выбору растворителей стали жизненно важным компонентом усилий по повышению экологичности тонкой химической промышленности, но было предпринято мало попыток подчеркнуть возобновляемость растворителей или просто включить в эти инструменты растворители биологического происхождения [56]. , 65, 66]. В дополнение к этанолу (который в настоящее время в основном производится из биомассы из-за его энергетического использования) [67] и ДМСО (производится путем окисления диметилсульфида, побочного продукта производства целлюлозы) [47], 2-MeTHF в настоящее время является единственным распространенный пример неотерического (то есть структурно нового или нетрадиционного) растворителя на биологической основе, который фигурирует в руководствах по выбору растворителя [68]. Хотя подавляющее большинство растворителей производится из ископаемых ресурсов, любой прогресс в выборе экологически чистых растворителей будет недальновидным, если возобновляемые растворители не будут рассматриваться на равной основе. Нетрадиционная функциональность неотерических растворителей может обеспечивать те же свойства, что и обычные растворители, но при этом избегать недостатков знакомых химических компонентов, таких как репротоксичные амиды [69, 70]. Обратите внимание, что общее определение неотерического растворителя также распространяется на ионные жидкости [71], водные системы растворителей [72], сверхкритические жидкости [73] и настраиваемые системы растворителей [74], безотносительно к происхождению растворителя.Однако эти типы растворителей еще не указаны в руководствах по выбору растворителей.

Руководства по выбору растворителей могут быть изменены, чтобы определить, какие растворители могут быть получены из биомассы, и насколько реалистичен переход от сырья к биомассе с учетом любых технологических проблем или экономических барьеров. Чтобы продемонстрировать это, сопоставленное руководство по выбору растворителя, разработанное Prat et al., обобщающее их «обзор руководств по выбору растворителя», как показано в Таблице 4 [57], было разделено на категории различного происхождения растворителя для целей этой работы ( Таблица 5).Колонка растворителей на биологической основе состоит из растворителей, произведенных из биомассы в больших масштабах, если не исключительно. Вода была включена в качестве растворителя на биологической основе для удобства. Те растворители, которые были обозначены как «, могут быть получены из возобновляемых источников » в Таблице 5, доступны на рынке, но биомасса не является основным сырьем. Растворители, которые могут быть получены из биомассы, считаются таковыми, если они получены из: биометанола (или синтез-газа), биоэтанола (или биоэтилена), биоуксусной кислоты, био-1-бутанола, биоизобутанола ( или биоизобутен) и биоацетон (также применимый в качестве потенциального предшественника изопропанола) [75]. Все это очень осуществимо, добавьте заменители на биологической основе, которые вписываются в существующие цепочки производства растворителей. Другие легкодоступные химические вещества на биологической основе, такие как глицерин, не перечислены, поскольку они не имеют отношения к растворителям, представленным в Таблице 5. Нежелательные хлорсодержащие растворители сгруппированы с растворителями, которые нельзя получить из предлагаемых промежуточных соединений на биологической основе. Это не обязательно нереалистичные растворители на биологической основе с технологической точки зрения (например, хлорирование метана на биологической основе), но у поставщиков нет стимула производить и распространять регулируемые канцерогенные растворители из возобновляемого сырья.

Таблица 5 Модифицированный вариант заключения к обзору руководств по выбору растворителей [57]

В сочетании с данными GSK об использовании растворителей за 2005 г. таблица 5 указывает на плохую интеграцию растворителей на биологической основе в фармацевтическую промышленность в то время. Хотя приятно видеть предпочтение использования гептана вместо n -гексана и ацетонитрила вместо других диполярных апротонов, ни один из них не является биологическим. Точно так же толуол и ДХМ обычно используются вместо других, еще более опасных ароматических и хлорированных растворителей, но опять же, это невозобновляемые растворители, находящиеся под контролем регулирующих органов, как обсуждалось ранее.Во многом это связано с отсутствием физико-химических данных и данных EHS для новых растворителей и, как таковое, с ограниченным пониманием их экологичности.

Более многообещающе то, что недавние документы, документирующие процедуры разработки процессов, показывают более широкое использование 2-MeTHF в крупномасштабном химическом синтезе [8]. Таблица 5 показывает, что доступны более экологичные растворители, а растворители на биологической основе хорошо представлены в категориях «рекомендуемые» и «между рекомендуемыми и проблемными». Легкодоступные растворители на биологической основе, как правило, представляют собой протонные растворители, а также сложные эфиры, кетоны и простые эфиры.Это оставляет потребность в экологически чистых и возобновляемых углеводородных растворителях и, в частности, в биполярном апротонном растворителе. В Таблице 5 не указаны нетрадиционные способы получения растворителей на биологической основе. Разработки в области преобразования биомассы в химические вещества ароматического происхождения [76] и специализированные способы получения метилэтилкетона [77] и ацетонитрила [78] означают, что все более разнообразное количество растворителей имеет перспективы в качестве возобновляемого сырья.

Два недавно опубликованных руководства по выбору растворителей теперь включают нетрадиционные растворители на биологической основе, опубликованные онлайн в журнале Green Chemistry с интервалом в 2 недели друг от друга [56, 65].Эти инструменты не были разработаны для описания устойчивости растворителей, но включение растворителей на биологической основе наравне с обычными растворителями демонстрирует некоторый положительный прогресс. Во-первых, консорциум проекта CHEM21 разработал второе руководство по выбору растворителя, основанное на той же методологии GHS, что и раньше (рис. 13), но теперь применяемой к неотерогенным растворителям (рис. 15) [56]. Снова семь баллов заштрихованы красным. Хотя эта модель в равной степени применима ко всем растворителям, эта модель часто делает вывод о том, что неотерические растворители являются «проблемными», поскольку доступно недостаточно токсикологических или экологических данных (это вывод по умолчанию, если данные отсутствуют, и он очевиден из выводов на рис.15). Авторы этого руководства по выбору растворителей призывают поставщиков растворителей собирать и публиковать данные об их продуктах, в противном случае неизвестный профиль новых растворителей для окружающей среды (E), здоровья (H) и безопасности (S) останется препятствием. Обнадеживает лишь небольшое количество красных баллов в критериях здоровья и безопасности нетрадиционных растворителей. В частности, они соответствуют безопасности простых эфиров циклопентилметилового эфира (CPME) и этилового эфира -трет--бутилового эфира (ETBE) с низкой температурой воспламенения, а также оценке здоровья репротоксичного тетрагидрофурфурилового спирта (THFA).

Рис. 15

Упрощенная версия руководства по выбору нетрадиционных растворителей CHEM21

Растворители с высокой температурой кипения (>200 °C) получают не менее семи баллов по экологическим показателям, заштрихованным красным цветом. Это происходит по технологическим причинам (удаление растворителя, сушка продукта), хотя и при условии, что необходима перегонка растворителя, что не всегда имеет место. Хотя это совершенно обоснованное опасение, оно означает, что глицерин и другие безвредные растворители представляются вредными для окружающей среды.В дополнение к ряду зеленых спиртов и сложных эфиров (включая бифункциональный этиллактат) -трет--амилметиловый эфир (TAME) был идентифицирован как подходящая замена менее желательным эфирным растворителям. Аналогичным образом, диметилкарбонат имеет хорошие оценки, но, несмотря на классификацию на рис. 15, ациклические карбонаты недостаточно полярны, чтобы их можно было считать прямой заменой классическим диполярным апротонным растворителям. Несмотря на то, что он считается «проблемным», p -цимол не имеет красных оттенков и как возобновляемый углеводород хорошо подходит для замены толуола и других ароматических растворителей [79–84].Циклические карбонаты [70, 85] и цирен [69] страдают от воздействия на окружающую среду из-за их высоких температур кипения, но имеют явные преимущества для здоровья по сравнению с классическими диполярными апротонными растворителями (рис. 13). Ни один из предложенных нетрадиционных диполярных апротонных растворителей не содержит атомов азота или серы, которые при сжигании могут привести к загрязнению воздуха NO x и SO x . Кроме того, циклический карбонат и цирен не имеют известных проблем с хронической токсичностью.

Второе руководство по выбору растворителя, расширяющее его охват на неотерические растворители, основано на кластеризации растворителей по сходству вычислений [65].Раскрывая свою мотивацию, авторы заявляют, что « существующие руководства по выбору растворителя дают только квази количественную информацию о степени экологичности растворителя » [65]. В этом новом подходе к разработке руководства по выбору растворителя был оценен и сгруппирован 151 растворитель в соответствии с их физико-химическими свойствами. К ним относятся температура плавления, температура кипения, поверхностное натяжение и т. д. Чтобы степень зелени растворителей можно было ранжировать на справедливой основе, кластерный анализ сгруппировал аналогичные растворители вместе.Кластер 1 состоит из неполярных и летучих растворителей. В этом кластере присутствуют легкие алифатические и олефиновые углеводороды, ароматические соединения и хлорсодержащие растворители. Менее летучие, но все же неполярные растворители образуют кластер 2 (включая гидрофобные высшие углеводороды, например, терпены, длинноцепочечные спирты и сложные эфиры). Кластер 3 состоит из полярных, обычно водорастворимых растворителей. Затем растворители в каждом кластере оценивали по 15 критериям (таблица 6). Если набор данных неполный, растворитель оценивается в соответствии с меньшими требованиями (называемыми уровнями достоверности). Чем меньше данных доступно для оценки экологичности, тем менее уверенным может быть пользователь в окончательном рейтинге. Токсикологических данных особенно не хватает для нетрадиционных и новых растворителей на биологической основе. Ранжирование выполняется на сравнительной основе внутри кластера, и баллы не могут сравниваться между кластерами.

Таблица 6 Критерии для руководства по выбору хемометрического растворителя

Как правило, кластер 1 содержит наиболее токсичные растворители. Учитывая, что растворителем с самым высоким рейтингом в этом наборе является диэтиловый эфир, становится ясно, что необходимы более экологичные альтернативы существующим неполярным и летучим растворителям, или, что еще лучше, меньшая зависимость от растворителей ЛОС в более общем плане (диэтиловый эфир потенциально образует перекись с очень низкая температура вспышки).Кластер 2 содержит много растворителей, не указанных в других руководствах по выбору растворителей, включая метиловые эфиры жирных кислот (МЭЖК) и терпены, которые достаточно хорошо оцениваются. Однако именно линейные нефтехимические углеводороды (додекан, ундекан, гептан) классифицируются как самые экологичные растворители в кластере 2 с высоким уровнем достоверности. Растворители группы 3 менее токсичны для водной среды и чаще имеют биологическую основу, чем две другие группы. Помимо пары хлорированных растворителей, кластер 3 в основном состоит из высокополярных растворителей (вода, глицерин, этанол, ацетонитрил и т.).

Как отсутствие данных влияет на ранжирование растворителей, можно продемонстрировать для выбранных растворителей в кластере 2 (рис. 16) [65]. Баллы для ранжирования устанавливаются от 1 до 0, но на рис. 16 показано только относительное положение растворителей, первым из которых является самый зеленый из 35 растворителей в кластере 2. Ни один из растворителей в кластере 2 не обладает фотохимическим потенциалом образования озона. (POCP), и, таким образом, нельзя было выполнить оценку озеленения с наивысшим уровнем достоверности. n -Гептан, например, имеет все данные, необходимые для ранжирования в соответствии с высоким уровнем достоверности. Занимая третье место, он считается более экологичным, чем метиллаурат (4-е место). С другой стороны, метилолеат в лучшем случае может быть оценен в соответствии со средним уровнем достоверности. При сравнении метилолеата с другими растворителями необходимо использовать тот же уровень достоверности и только для кластера 2. Резкое снижение воспринимаемой зелени происходит для n -гептана при переходе к среднему и низкому уровням достоверности, где меньше данных. применяется в рейтинге (рис. 16). В целом традиционные алканы и углеводороды на биологической основе уступают место МЭЖК при среднем и низком уровнях достоверности.Лимонен и p -цимол более устойчивы к падению в рейтинге, отчасти потому, что они возобновляемы, и это один из пяти критериев, остающихся на самом низком уровне достоверности. Противоречивые интерпретации n -гептана, иногда рассматриваемого в первой тройке по зелени, а иногда и в нижней 2, сильно подчеркивают, что данные имеют первостепенное значение. Для менее распространенных растворителей требуется больше качественных данных, но также имеет решающее значение то, какие данные выбираются и используются для оценки экологичности.Природа зеленой химии как прикладной дисциплины в определенной степени зависит от суждений. Это означает, что нельзя ожидать консенсуса, и всегда остается место для разногласий.

Рис. 16

Рейтинг выбранных растворителей из кластера 2 руководства по выбору хемометрического растворителя

Хемометрический подход к кластеризации и ранжированию растворителей подтвердил, что некоторые типы растворителей имеют изначально нежелательные характеристики. Следовательно, выбор растворителя на основе прямого замещения «аналогичный» является ограничительным.Опираясь только на существующий каталог в основном традиционных растворителей, невозможно иметь зеленый заменитель растворителя, доступный для каждого применения. Зеленые растворители имеют тенденцию быть похожими (например, спирты и сложные эфиры), поэтому в некоторых областях применения растворителей можно найти множество вариантов зеленых растворителей, но в других остается острая потребность. Также было показано, что выводы руководства по выбору растворителя могут полностью измениться в зависимости от того, какие данные используются, что, безусловно, подрывает уверенность в использовании этих инструментов.

Замените растворитель проблем

  • Главная Замена растворителя проблем

Вдумчивый выбор растворителя позволяет компаниям снизить воздействие своих продуктов и процессов на окружающую среду, поддерживать более безопасные условия на рабочем месте и обеспечивать своим клиентам более безопасный пользовательский опыт. Первые шаги, необходимые для выбора подходящей альтернативы проблемному растворителю, включают сбор информации.Информация, размещенная на сайте Gaylord по замене растворителей, предназначена для предоставления начальной информации тем, кто заинтересован в поиске более безопасного растворителя для своих продуктов и процессов. В дополнение к этой информации Гейлорд предлагает консультации, чтобы помочь компаниям, желающим работать с ДМСО.

Пожалуйста, свяжитесь с нами по любым вопросам поддержки рецептур, мы будем рады помочь.

г / 100 г H30 @ 25 ° C 95-05-8 0.27117 95-09-9 98-56-6
Solvent Class Solvent CAS # CAS # MP, ° C BP, ° C BP, ° C BP, ° C Растворимость воды Уровень испарения
(Buoac = 1)
VOC Воспламеняемость
Температура вспышки,
°C (CC)
Законодательные ограничения
Спирт н-бутанол 71-36-3 -89.8 117 9 0,46 100% 29
Изопропиловый спирт (IPA) 67-63-0 -89. 5 82.9 92.09272 1,7 100% 12
этанол 64-17-5 64-17-5 -114.1 78.2 98.2 1,7 100% 13
Метанол 67-56-1 -98 64.7 Смешивается 2,9 100% 11
Алифатический углеводород минеральные духи 8052-41-3 -58 -58 149-213 Нерастворимый 0.13 100% 40
Гексан 110-54-3 -95 69 Нерастворимый 8.3 90% 90%
Ароматические углеводороды AR-150 64742-94-5 Н/Д 179 Незначительно07 100% 66
ToLueol 108-88-3 -95 111 0,07 0,07 29 100% 4
Benzene 71-43-2 91-43-2 5. 5 80.1 1.88 3.5 100% — 11.63
Карбоновая кислота Муравьиная кислота 64-18-6 8.3 101 Смешивается 2.1 100% 50
уксусная кислота 64-19-7 16.7 118 118 118 0,97 100% 40
Dipolar Arricic Диметилсульфоксид 67-68-4 67-68-4 18.55 189 0.026 100% 89
N, N — Диметилацетамид (ДМАЦ) 129-19-5 -20 165 Смешивается 9027 2 100% 63
N -метилпирролидон (NMP) 9872-50-4 -24 -24 202 100 0. 03 806-1026 г / л 86 Reake Bange1
ацетонитрил (ACN) 75-05-8 -46 81 91 5.8 100% 6
N, N — Диметилформамид (ДМФ) 68-12-2 -61 153 Смешивается 100% 58
Nitromethane 75-52-5 75-52-5 -28.7 101.2 111 1,3 100% 36
Эстер
Пропиленок карбонат 108-32-7 -49 241 25 0,005 освобожден 132 132
Этилацетат (ETAC) 141-78-6 -84 77 10 4.1 100% -3
Метил соат 67784-80-9 >200 Нерастворимый 4% >94 94 94 94 94
Эфир
Ether тетрагидрофуран (ТГФ) 109-99-9 -108 66 66 9 8 100% -17
1,3 Диоксолан 646-06-0 -95 75 Смешивается 3. 5 100% -3
1,4-Dioxane 12-91-1 11.8 101 9 29 100% 12
диэтиловый эфир 60271 -116 34.6 8 11.8 100% -40
Бутилцеллюлозольв (карбитол) 111-90-0 -76 202 Смешивается 0.01 91
Галогенированный углеводородный DichloromeThane 75-092 -97 40 2 29,5 освобождение
Пархлорбензотрифторид (PCBTF) 98-56-6 -36 138 Нерастворимый 0.9 освобожден 43
Хлороформ 67-66-3 -63. 5 61,2 7,95 11,6 100%
Ketone Acetone Acetone 67-64-1 -95 56 9 6.3 освобождены -17
метила изобутил кетон (MIBK) 108-10-1 -84 117 2 1.6 100% 14
Вода 7732-18-5 0 100 0.3 Нет

Поиск альтернатив NMP, используемому в качестве растворителя в клеях, тканях с покрытием и принтах


Резюме

Нулевой выброс опасных химических веществ (ZDHC) добавлен в список кандидатов ZDHC MRSL N-метил-2-пирролидон; 1-метил-2-пирролидон (CAS NO 872-50-4), используемый в качестве растворителя в клеях, тканях с покрытием, принтах и ​​т. д.и он ищет дополнительную соответствующую информацию о возможных альтернативах.

Фонд ZDHC наблюдает за реализацией программы «Дорожная карта к нулю» и представляет собой глобальную многостороннюю инициативу, в которой в настоящее время участвуют 162 участника (30 брендов, 111 аффилированных лиц в цепочке создания стоимости и 21 партнер) в индустрии моды и обуви.


Описание

Фонд нулевого выброса опасных химических веществ (ZDHC) добавил в список кандидатов ZDHC MRSL N-метил-2-пирролидон; 1-метил-2-пирролидон (CAS NO 872-50-4), используемый в качестве растворителя в клеях, тканях с покрытием, принтах и ​​т. д.Целью этого запроса является сбор дополнительной соответствующей информации о возможных альтернативах для упомянутых видов использования.

Список запрещенных к производству веществ ZDHC (ZDHC MRSL) представляет собой список химических веществ, запрещенных к преднамеренному использованию на предприятиях, обрабатывающих текстильные материалы, кожу, резину, пену, клеи и детали отделки текстиля, одежды и обуви.

ОТКАЗ ОТ ОТВЕТСТВЕННОСТИ: Фонд ZDHC не должен рассматриваться в качестве потенциального покупателя. Ни при каких обстоятельствах ZDHC (и/или любые связанные с ZDHC юридические лица, директора или сотрудники) не будет нести ответственность перед какой-либо стороной за любое решение или действие, предпринятое на основании или на основе информации на этом сайте, или за любые последующие, специальные или аналогичные убытки, даже если они были предупреждены о возможности таких убытков.


Альтернатива должна заменить

N-метил-2-пирролидон; 1-метил-2-пирролидон (CAS NO 872-50-4), используемый в качестве растворителя в клеях, тканях с покрытием, гравюрах и т. д.


Неводный цвиттерионный растворитель в качестве альтернативы диметилсульфоксиду в медико-биологических науках

Клетки

Человеческий нормальный фибробласт-1 (hNF-1, KF-4009) был приобретен у Kurabo Industries Ltd. Человеческий нормальный фибробласт-2 (hNF-2) и mNF были любезно предоставлены профессором Эриком Сахаи (Институт Фрэнсиса-Крика, Великобритания) и описаны ранее 29 . Клетки рака молочной железы человека MDA-MB-231 и клетки меланомы человека WM266.4 также являются любезным подарком от профессора Эрика Сахаи. Клетки рака легкого человека PC9 и клетки почки собаки Mardin-Darby являются любезными подарками профессора Сэйдзи Яно (Институт исследования рака Университета Канадзавы) и профессора Эцуко Киёкава (Медицинский университет Канадзавы) соответственно. Первичные астроциты мышей были получены из умерщвленных новорожденных мышей C57BL6 (P1-3, самцы и самки), как сообщалось ранее 30 .Все клетки, кроме hNF-1, выращивали и поддерживали в виде монослойных культур при 37 °C в 5% CO 2 во влажной атмосфере с использованием DMEM (высокая глюкоза с L-глутамином и феноловым красным, Fujifilm Wako Pure Chemical Corporation), с добавлением раствора пенициллина-стрептомицина (×100) (Fujifilm Wako Pure Chemical Corporation) и 10 об. % FBS (Sigma-Aldrich Co., Llc.). Клетки субкультивировали каждые 4–6 дней, используя раствор трипсина (0,5% масс./об.% трипсина — 5,3 ммоль/л раствора ЭДТА·4Na без фенолового красного (×10), Fujifilm Wako Pure Chemical Corporation).hNF-1 выращивали и поддерживали в виде монослойных культур при 37 °C в 5% CO 2 во влажной атмосфере с использованием DMEM (с низким содержанием глюкозы с L-глутамином и феноловым красным, Sigma-Aldrich Co., Llc.) и 5 об.% FBS (Thermo Fisher Scientific Inc.). hNF-1 субкультивировали каждый месяц с использованием раствора трипсина (0,25%, Nacalai Tesque, Inc.), приготовленного с фосфатно-солевым буфером Дульбекко (DPBS, без кальция, без магния, Thermo Fisher Scientific Inc.).

Исследование содержания ZIL в клетках

ZIL был синтезирован, как сообщалось 12 .Около 5 × 10 5 клеток инкубировали в 5% (вес/объем) ZIL в DMEM через 2 часа. Клетки механически измельчали ​​с помощью клеточного скребка в 2 мл метанола после шестикратной промывки PBS (каждая по 2 мл). Растворы центрифугировали и фильтровали перед проведением масс-спектрометрии (JMS-T100TD, JEOL Ltd) посредством ионизации электрораспылением. Объем клеток рассчитывали путем измерения радиусов клеток при микроскопическом наблюдении с помощью инвертированного микроскопа IX83 (Olympus Corporation).

Токсичность растворителей для клеток

Аналог ZIL 1 был синтезирован, как сообщалось 12 . Аналог ЗИЛ 2 был приобретен у Iolitech GmbH и использован после сушки. hNF-2 и mNF высевали в 96-луночные планшеты по 4 × 10 3 клеток в каждой лунке. В каждую среду добавляли растворители в указанных концентрациях. После культивирования в течение 24 ч жизнеспособность клеток исследовали с помощью CellTiter 96® Aqueous One Solution (Promega Corporation). hNF-1 высевали в 96-луночные планшеты по 2 × 10 4 клеток в каждой лунке.После 24-часового культивирования в смесях среда/растворитель в указанных концентрациях культуральную среду меняли на другую среду с добавлением 33 мг/мл нейтрального красного. Через 2 ч культивирования клетки промывали PBS и экстрагировали нейтральный красный цвет 0,1 М HCl–30% раствором этанола. Жизнеспособность клеток рассчитывали по поглощению при 650 нм (получено из нейтрального красного) и 550 нм (получено из самих клеток).

Моделирование МД

Клеточная мембрана в системе моделирования состояла из липидов диолеоилфосфатидилэтаноламин (ДОФЭ)–диолеоилфосфатидилглицерин (ДОФГ) в соотношении 3:1 (90 и 30 молекул соответственно).Липидный бислой помещали в центр прямоугольного периодического ящика, заполненного водой TIP3P и ZIL (с 8716 и 32 молекулами соответственно), где размер буфера между краями ящика и липидной моделью был установлен на уровне около 34 Å, а МД-моделирование клеточной мембраны в водном растворе ZIL с концентрацией 5 % масс. проводили с использованием программного обеспечения Amber18 и AmberTools19 31 .

Система клеточных мембран была оптимизирована и постепенно нагревалась от -253 до 37°C со скоростью 0,1°C/пс. Затем последовала динамика производства при постоянной температуре (37 °C) и давлении (1 бар) в течение 2.5 мкс. Молекулы липидов были описаны с помощью силового поля Lipid17 32 , а молекулы ZIL были смоделированы с использованием параметров GAFF. Моделирование МД выполнялось с использованием временного шага интегрирования 2 фс в сочетании с опцией SHAKE. Метод сетки частиц Эвальда (PME) был принят для дальнодействующих взаимодействий, а отсечка несвязывающих взаимодействий в координатном пространстве была зафиксирована на уровне 10 Å. Атомы, использованные для расчетов, показаны на дополнительном рис. 7. Научная Инк.) в соответствии с протоколом производителя. Вкратце, клетки инкубировали с 10 мкМ EdU в течение 1 часа. Затем клетки обрабатывали трипсином, фиксировали 4% PFA, пермеабилизировали и метили пиколиазидом Alexa Fluor 647. Затем клетки окрашивали 4′,6-диамидино-2-фенилиндолом (DAPI) и анализировали с помощью BD FACSAria TM III (BD Biosciences).

Иммуноблоттинг фосфо-Rb

Белковые лизаты обрабатывали в соответствии со стандартными процедурами и анализировали с помощью SDS-PAGE с последующим иммуноблоттингом. Готовые SDS-полиакриламидные гели (4–15% Mini-PROTEAN TGX Precast Gel) и система переноса Trans-Blot Turbo были приобретены у Bio-Rad. Связанные антитела обнаруживали с помощью вторичных антител, конъюгированных с IRDye680 или IRDye800, и анализировали с помощью системы Odyssey Imager (LI-COR. Inc.). В этом исследовании использовали следующие антитела: кроличье антитело против фосфо-Rb (Ser780) (9307) от Cell Signaling Technology и мышиное антитело против β-тублина (T7816) от Sigma-Aldrich Co., Llc.

Культура клеток: iPS-клетка

Линия iPS-клеток человека 201B7 была предоставлена ​​RIKEN BRC в рамках Национального проекта биоресурсов MEXT/AMED, Япония.Линию клеток выращивали и поддерживали путем культивирования фидерных клеток (SL10, Reprocell Inc.) при 37°C в 5% CO 2 во влажной атмосфере с использованием среды клеток Primate ES (Reprocell Inc.), дополненной bFGF ( Fujifilm Wako Pure Chemical Corporation).

Клетки субкультивировали, когда клетки достигли 80% конфлюэнтности, с использованием клеточного скребка (AGC Techno Glass Co. , Ltd) после обработки DPBS(-) (без кальция, без магния, Thermo Fisher Scientific Inc.) и раствор ЧТК. раствор ЦТК (0.25% трипсин + 1 мг/мл коллагеназы IV + 1 мМ CaCl 2  + 20% KSR в DPBS (-)) готовили с трипсином ((2,5%), без фенолового красного, Thermo Fisher Scientific Inc.), коллагеназой ( тип IV, порошок, Thermo Fisher Scientific Inc.), дигидрат хлорида кальция (Fujifilm Wako Pure Chemical Corporation), заменитель сыворотки Knock Out TM (KSR, Thermo Fisher Scientific Inc.).

Токсичность ZIL и ДМСО для iPS-клеток

iPS-клетки удаляли из чашек при 80% слиянии с использованием раствора CTK и промывали DPBS (-).Удаленные клетки обрабатывали 0,5× раствором TrypLE Select. 0,5× Раствор TrypLE Select готовили из 50% TrypLE Select, без фенолового красного (Thermo Fisher Scientific) и 0,25 мМ ЭДТА (0,5 моль/л раствора ЭДТА (pH 8,0), Nacalai Tesque Inc.) в DPBS (-) для однократного культура клеток. Клетки собирали в среду с 10 мкМ Y-27632 (Fujifilm Wako Pure Chemical Corporation) и центрифугировали. Перед использованием супернатант удаляли.

Фидерные клетки высевали 1,25 × 10 4 клеток/лунку в 96-луночный планшет и культивировали в течение 1 дня в среде, содержащей bFGF и Y-27632, а iPS-клетки дополнительно высевали 5000 клеток/лунку и культивировали на 1 день.Питательную среду заменяли средой с добавлением ДМСО (CultureSure DMSO, Fujifilm Wako Pure Chemical Corporation) или ZIL. Клетки культивировали до тех пор, пока контрольный образец (не содержащий растворителей) не достиг конфлюэнтности на 80%. Жизнеспособность клеток подтверждали с использованием реагента для подсчета клеток SF (Nacalai Tesque Inc.). Культуральную среду заменяли средой с добавлением 10% реагента для подсчета клеток SF и инкубировали в течение 1 часа. После инкубации измеряли поглощение при 450 нм и переводили в жизнеспособность клеток с помощью стандартной кривой.

Количественное определение недифференцированных маркеров

Фидерные клетки высевали 1,25 × 10 4 клеток/лунку в 96-луночный планшет и культивировали в течение 1 дня, а iPS-клетки дополнительно высевали в количестве 5000 клеток/лунку и культивировали в течение 1 дня . Культуральную среду заменяли средой, включающей ДМСО или ZIL, и клетки культивировали до тех пор, пока контрольный образец (который не содержит растворителей) не достигал 80% конфлюэнтности. Суммарную РНК экстрагировали и преобразовывали в кДНК с использованием набора кДНК FastLane Cell (Qiagen).Экспрессию Nanog и Oct3/4 количественно определяли с использованием системы ПЦР в реальном времени LightCycler® 96 (Roche) и SYBR Premix Ex Taq II (Tli RNaseH Plus) (95°C, 5 с; 60°C, 30 с; 40 циклов). Gapdh использовали в качестве внутреннего контроля. Последовательности праймеров следующие: Nanog , прямой: GACAGGGGGAGGGGAGGAGCTAGG, обратный: CTTCCCTCCAACCAGTTGCCCCAAAC; 3/4 октября вперед: CAACTGGCCGAAGAATAGCA, обратно: TCCCTGGTGGTAGGAAGAGTAAA; Gapdh вперед: CATCCCTGCCTCTACTGGCGCTGCC, обратно: CCAGGATGCCCTTGAGGGGGCCCTC.

Токсичность растворителей для эмбрионов рыбок данио

Все эксперименты на животных проводились в соответствии с протоколом, утвержденным комитетом по экспериментам на животных Канадзавского университета. Штамм рыбок данио дикого типа, AB*, выращивали в системе циркуляционного аквариума (AQUA) при температуре 28,5 °C с циклом свет/темнота 14/10 ч и содержали в соответствии с рекомендациями комитета по экспериментам на животных Канадзавского университета. Эмбрионы инкубировали в среде E3 (5 мМ NaCl, 0.17 мМ KCl, 0,33 мМ CaCl 2 , 0,33 мМ MgSO 4 ), содержащие ДМСО или ZIL, от 1,5 до 24 hpf. Затем эмбрионы дважды промывали средой E3 и обрабатывали 1-фенил-2-тиомочевиной (Fujifilm Wako Pure Chemical Corporation) для предотвращения пигментации. Эмбрионы через 48 часов после оплодотворения окрашивали 0,6 мг/мл o -дианизидина (Tokyo Chemical Industry Co., Ltd) в течение 15 мин с последующей фиксацией 4% параформальдегидом (Fujifilm Wako Pure Chemical Corporation). Затем эмбрионы дважды промывали 0.1% Tween-20 (Sigma-Aldrich Co., Llc.) в PBS. Изображение эмбрионов в видимом свете получали с помощью микроскопа Axiozoom V16 (Carl Zeiss AG) с цифровой камерой TrueChrome II (BioTools Inc. ) и программным обеспечением TCapture (версия 4.3.0.602) (Fuzhou Tucsen Photonics Co., Ltd).

Анализ растворимости лекарств

Лекарства (1 мас.%) добавляли к растворителям и перемешивали в течение 10 ч при комнатной температуре. Когда препараты не растворялись, растворы нагревали до 80 °С и перемешивали в течение 2 ч.Мы проверили, солюбилизированы ли лекарства, наблюдая за частицами лекарств с помощью инвертированного микроскопа (ECLIPSE Ts2, Nikon Corporation). Эритромицин, 3′-азидо-3′-дезокситимидин, 5-йодо-2′-дезоксиуридин, (+)-катехингидрат, L-адреналин, дезлоратадин, моногидрат золедроновой кислоты, тестостерон, эстриол и оксалиплатин были приобретены у Tokyo Chemical Industry. Co., Ltd и используется в том виде, в каком он был получен. Фторурацил, карбоплатин и цисплатин были приобретены у Fujifilm Wako Pure Chemical Corporation и использованы в готовом виде.Аденозин-3′-фосфат и инсулин были приобретены у Nacalai Tesque Inc. и использовались в готовом виде. l-Тироксин был приобретен у Sigma-Aldrich Co. , Llc. и используется в том виде, в каком он был получен. Паклитаксел был приобретен у Funakoshi Co., Ltd и использован в том виде, в каком он был получен.

Анализ жизнеспособности клеток с цисплатином

MDA-MB-231 высевали по 5000 клеток на лунку в 96-луночный планшет и предварительно культивировали в течение 24 часов. Раствор цисплатина (10  мМ) готовили с использованием 25 или 50% (вес/объем) растворов ZIL или 100, 50 или 25% (об/об) растворов ДМСО и оставляли более чем на один день.Их добавляли в среду в предполагаемых концентрациях. После 72-часового культивирования жизнеспособность клеток исследовали с помощью CellTiter 96® Aqueous One Solution.

Криоконсервация

Растворы ДМСО и ЗИЛ готовили путем смешивания со сверхчистой водой или DMEM/FBS. Клетки (1 × 10 6 клеток) собирали в пробирки для образцов на 1,5 мл (Watoson Co., Ltd) и центрифугировали. После удаления супернатанта добавляли 100 мкл среды для замораживания и медленно пипетировали. Образцы хранились в течение 3–5 дней в ящике (г.Frosty, Thermo Fisher Scientific Inc.) для охлаждения со скоростью около –1 °C/мин в морозильной камере –85 °C. Замороженные образцы оттаивали, добавляя культуральную среду при 37 °C. Количество живых клеток подсчитывали с помощью автоматического счетчика клеток (Countess II, Thermo Fisher Scientific Inc.) после окрашивания трипановым синим путем пипетирования в течение примерно 10 с. Относительное количество живых клеток определяется следующим уравнением:

относительное количество живых клеток = подсчитанное количество живых клеток (образец)/подсчитанное количество живых клеток (контроль),

где контроль представляет собой клетки, криоконсервированные с помощью коммерчески доступного криопротектора, Среда для замораживания CultureSure (CS-FM, Fujifilm Wako Pure Chemical Corporation).Затем клетки высевали на шестилуночный планшет, культивировали в течение 24 ч и визуализировали с помощью инвертированного микроскопа (IX83, Olympus). После визуализации клетки обрабатывали трипсином, повторно суспендировали в полной среде и подсчитывали относительное количество живых клеток с помощью Countess II после окрашивания трипановым синим. Фазовое поведение растворов исследовали с помощью DSC (DSC-60A plus, Shimadzu Corporation).

Статистический анализ

Данные были подвергнуты однофакторному анализу ANOVA с последующим тестом множественных сравнений Даннета.При сравнении двух групп применяли двусторонний непарный критерий Стьюдента t -критерий.

Сводка отчета

Дополнительную информацию о дизайне исследования можно найти в Сводке отчета об исследовании природы, связанной с этой статьей.

4. Токсикология растворителей | Война в Персидском заливе и здоровье: Том 2: Инсектициды и растворители

Бурек Д.Д., Ничке К.Д., Белл Т.Дж., Вакерле Д.Л., Чайлдс Р.К., Бейер Д.Э., Диттенбер Д.А., Рэмпи Л.В., МакКенна М.Дж. 1984. Метиленхлорид: двухлетнее исследование ингаляционной токсичности и онкогенности на крысах и хомяках. Фундаментальная и прикладная токсикология 4(1):30–47.


Казанова М., Белл Д.А., Хек Х.А. 1997. Метаболизм дихлорметана в формальдегид и реакция формальдегида с нуклеиновыми кислотами в гепатоцитах грызунов и человека с генами глутатион-S-трансферазы Т1 и М1 и без них. Фундаментальная и прикладная токсикология 37:168–180.

Кэттли Р.С., ДеЛука Дж., Элкомб С., Феннер-Крисп П., Лейк Б.Г., Марсман Д.С., Пастур Т.А., Попп Дж.А., Робинсон Д.Е., Шветц Б., Тагвуд Дж. и Вали В.1998. Представляют ли соединения, пролиферирующие пероксисомы, гепатоканцерогенную опасность для человека? Регуляторная токсикология и фармакология 27 (1 часть 1): 47–60.

Чан Ю.С. 1987. Нейротоксическое воздействие н-гексана на центральную нервную систему человека: вызванные потенциальные аномалии при н-гексановой полиневропатии. Журнал неврологии, нейрохирургии и психиатрии 50(3):269–274.


Дэвид Р.М., Тайлер Т.Р., Уэллетт Р. , Фабер В.Д., Бэнтон М.И. 2001. Оценка субхронической токсичности паров н-бутилацетата. Пищевая и химическая токсикология 39:877–886.

Диксит В.П., Гупта Р.С., Кумар С., Джоши Б.К. 1980. Обратимая химическая стерилизация: влияние введения циклогексанола на семенники и придатки яичка кролика-самца. Индийский журнал физиологии и фармакологии 24(4):278–286.


Старейшина Р.Л. 1989. Заключительный отчет по оценке безопасности этилацетата и бутилацетата. Журнал Американского колледжа токсикологии 8(4):681–705.


FDA (Управление по санитарному надзору за качеством пищевых продуктов и медикаментов).1989. Косметика; запрет на использование хлористого метилена в составе косметических средств. Федеральный регистр 54(124):27328–27342.

Feldman R. 1998. Нейротоксикология труда и окружающей среды . Филадельфия: Липпинкотт-Рейвен.

Franco G, Fonte R, Tempini G, Candura F. 1986. Концентрация желчных кислот в сыворотке как тест функции печени у рабочих, подвергающихся профессиональному воздействию органических растворителей. Международный архив гигиены труда и окружающей среды 58(2):157–164.

Frantz SW, Beskitt JL, Grosse CM, Tallant MJ, Dietz FK, Ballantyne B. 1996. Фармакокинетика этиленгликоля. II. Распределение в тканях, дозозависимая элиминация и идентификация метаболитов с мочой после однократного внутривенного, перорального или чрескожного введения у самок крыс Sprague-Dawley и мышей CD-1. Xenobiotica 26(11):1195–1220.


Грэм, Д.Г., Амарнат В., Валентайн В.М., Пайл С.Дж., Энтони Д.К. 1995. Патогенетические исследования нейротоксичности гексана и сероуглерода. Критические обзоры по токсикологии 25:91–112.

Green T. 1997. Опухоли печени и легких у мышей, индуцированные метиленхлоридом: обзор роли механистических исследований в оценке безопасности для человека. Человеческая и экспериментальная токсикология 16(1):3–13.

Green T. 2000. Легочная токсичность и канцерогенность трихлорэтилена: видовые различия и способы действия. Environmental Health Perspectives 108(Suppl 2):261–264.

Грин Т., Одум Дж., Нэш Дж. А., Фостер Дж. Р.1990. Опухоли почек крыс, индуцированные перхлорэтиленом: исследование задействованных механизмов и их значение для человека. Токсикология и прикладная фармакология 103(1):77–89.


Хуан К.С., Чу Н.С., Ченг С.И., Шин Т.С. 1989. Двухфазное выздоровление при н-гексановой полиневропатии. Клиническое и электрофизиологическое исследование. Acta Neurologica Scandinavia 80(6):610–615.


Ичихара Г., Сайто И., Камидзима М., Ю Х., Шибата Э., Тоида М., Какеучи Ю. 1998.Содержание 2,5-гександиона в моче увеличивается с усилением нейротоксичности при хроническом совместном воздействии н-гексана и метилэтилкетона. Международный архив гигиены труда и окружающей среды 71(2):100–104.


Jorgenson TA, Meierhenry EF, Rushbrook CJ, Bull RJ, Robinson M. 1985. Канцерогенность хлороформа в питьевой воде для самцов крыс Osborne-Mendel и самок мышей B6C3F1. Фундаментальная и прикладная токсикология 5(4):760–769.


Китчин К.Т., Браун Д.Л.1989. Биохимические эффекты трех канцерогенных хлорированных метанов в печени крыс. Тератогенез, канцерогенез и мутагенез 9(1):61–69.

Klaassen CD, Rozman K. 1991. Распределение, выделение и всасывание токсикантов. В: Klaassen CD, Amdur MO, Doull J, ред. Токсикология Казаретта и Доулла: фундаментальная наука о ядах . 4-е изд. Нью-Йорк: Пергамон Пресс. Стр. 50–57.


Озеро Б.Г., Фостер Дж.Р., Коллинз М.А., Стабберфилд К.Р., Ганголли С.Д., Сривастава С.П.1982. Исследования воздействия перорально введенного дициклогексилфталата на крыс. Acta Pharmacologica et Toxicologica (Копенгаген) 51(3):217–226.

Лакинд Дж.С., МакКенна Э.А., Хабнер Р.П., Тардифф Р.Г. 1999. Обзор сравнительной токсичности этиленгликоля и пропиленгликоля для млекопитающих. Critical Reviews in Toxicology 29(4):331–365.

Amazon.com: клей-растворитель C-22 от Walker Tape C22 Solvent Spray 4Oz Spray для кружевных париков и париков: красота и личная гигиена

Обычно я не пишу обзоры, если продукт/услуга не являются либо ужасно ХОРОШИМИ, либо ужасными, разумеется, я пишу этот, потому что я.ЯВЛЯЮСЬ. ВАЖНО!

Я совсем новичок в кружевных париках. Я с головой погрузился в установку с помощью клея Ghost Bond (кстати, он определенно делает то, что должен). Как вы понимаете, у меня остались комочки запекшегося клея, а точнее около 4 слоев, лол. Я не был готов * вставить голос Кевина Харта.

В состоянии паники я поехала в ближайший магазин косметики и нашла якобы быстродействующее средство для снятия клея от салона про (определенно не тратьте деньги на ЭТО). Я использовал почти половину бутылки и смог смыть клей только с центра лба (не спрашивайте, лол).Средство для удаления клея также имеет ОЧЕНЬ сильный запах, который сохраняется до тех пор, пока вы не помоете голову, и пленку остатков липкого клея, так как он разрушает клей, но на самом деле не отделяет клей от ваших волос, я надеюсь, что это имеет смысл.

В любом случае, когда я впервые получил свой парик, я бы заказал растворитель с-22, но из-за недавних задержек с доставкой он пришел только сегодня. Я вообще не ожидал от него многого, потому что, если вы пробовали одно средство для удаления клея, вы пробовали их, хорошо? НЕПРАВИЛЬНЫЙ!!!!!. Я открыла флакон и сразу заметила, что запах стал намного тоньше и приятнее! Он легкий и цитрусовый.Я распылил 3 струи на одну пораженную область и начал свое телешоу, ожидая, что буду сидеть там, вычесывая клей из волос в течение следующего часа, СУКА! Это заняло 3 минуты! Я вычесал КОМОКИ клея с нетронутыми волосами! Это тоже было практически безболезненно! Нет пленки, нет остатка. Я подумал, что это розыгрыш, поэтому повторил шаги на другом виске, результат тот же!

Я не был готов оставить отзыв, поэтому у меня нет сравнительных фотографий, чтобы показать, как выглядела моя линия роста волос после ЧАСОВ удаления клея с помощью первого растворителя, но прилагаемые фотографии показывают, что сделали 5 минут с использованием растворителя c-22. Вы можете увидеть остатки, но это всего лишь остатки клея, которые ЛЕГКО можно вычесать. Я надеюсь, что это поможет

* на самом деле они не позволят мне прикрепить фотографии.. облом. Я все еще надеюсь, что этот обзор поможет кому-то. Мой тип волос 4b..очень кудрявые волосы, и у меня полная линия роста волос.

SOLJET Pro 4 XR-640 64-дюймовый струйный экосольвентный принтер/каттер

Теплоноситель не прилипает к ткани должным образом.

Нынешний пользователь Roland хочет перейти с экосольвентных чернил на сублимационные чернила

Могут ли машины для печати и резки разрезать саржу?

Мне нужна прозрачная пленка, совместимая с моим экосольвентным принтером, на котором я могу печатать позитивы.

Таблица цветных продуктов (EcoSol/UV/Sublimation), которая включает различные конфигурации, типы чернил и номера деталей для чернил. Эта статья была оптимизирована для просмотра на мобильных устройствах.

Исчезает линия CutContour в файле PDF.

Подозреваемые проблемы с обнаружением меток обрезки, проблемы со смещением обрезки

Жесткий сбой принтера в направлении сканирования

Настенная графика либо отваливается, либо слишком агрессивно прилипает к стене

Как устранить белые полосы (или падение плотности, полосы, нехватку чернил)

Есть ли способ остановить мытье головы?

Плохая пригодность для печати; не цепляется за поверхность стекла

Принтер не распознает новый чернильный картридж, или у клиента неисправный чернильный картридж, из-за которого возникают проблемы с печатью.

ПОМОЩЬ!! Я потерял компакт-диск с программным обеспечением для моей машины!

ПОМОЩЬ!! Я потерял DVD/CD с программным обеспечением для моей машины!!

Общая информация о OnSupport

Las impresoras де inyección де тинта Роланд хан Сидо diseñadas пункт permanecer inactivas соло durante бревес периодос де tiempo. Cuando не está siendo usada, cada impresora lleva a cabo un mantenimiento automático. Sin эмбарго, hay algunas situaciones que requieren periodos prolongados de inactividad, especialmente en entornos educativos. Es Importante Preparar Correctamente estos dispositivos para largos periodos de inactividad con el propósito de evitar daños y garantizar que estén en perfectas condiciones de producción al momento de imprimir nuevamente.

Струйные принтеры Roland рассчитаны на короткие периоды простоя.Каждый принтер выполняет автоматическое обслуживание, когда машина не используется. Однако в некоторых ситуациях требуются длительные периоды простоя, особенно в образовательных учреждениях. Важно правильно подготовить эти устройства к длительному простою, чтобы предотвратить повреждение и убедиться, что ваша машина находится в идеальном рабочем состоянии, когда вы будете готовы снова начать печать.

Почему некоторые из моих рисунков на текстиле выглядят размытыми, а другие нет?

HTM2 отслаивается в секциях после стирки.

Повреждение стены и/или краски при удалении WFRV и/или WFRF.

Управляйте выводом на печать с помощью последней версии самого популярного в мире программного обеспечения RIP.

Статус чернил Roland VersaWorks

Руководство по настройкам RVW при печати белым цветом на прозрачном материале.

Могу ли я использовать любой из этих чистящих картриджей взаимозаменяемо?

Могу ли я использовать любой из этих чистящих картриджей взаимозаменяемо?

SOLJET Pro II VersaWorks больше не продается

Плашечный цвет с предупреждением о прозрачности появляется при попытке сохранить файл в формате eps в Adobe Illustrator.

В этом документе указаны правильные модели TU, HU и BU для различных моделей принтеров, где это применимо.

Часто задаваемые вопросы по VersaWorks 6 — включает поддерживаемые устройства, требования к компьютеру и информацию о загрузке/установке.

Часто задаваемые вопросы по VersaWorks 6 — включает поддерживаемые устройства, требования к компьютеру и информацию о загрузке/установке.

Заинтересованы в обновлении до VersaWorks 6

Versaworks не будет печатать задания одновременно, если установлено несколько машин.

Часто задаваемые вопросы о VersaWorks, VersaWorks Dual и VersaWorks 6

Настенная графика отваливается через несколько часов после применения.

При выводе дизайна на принтер программное обеспечение должно иметь возможность преобразовывать команды на устройство (например, сколько чернил использовать и когда). Эти команды сообщают машине, как быстро подавать материал, с какой скоростью движется каретка и какие параметры нагрева необходимы для печатного валика. Другие переменные включают в себя свойства материала, на котором выполняется печать, реакцию на него химического состава чернил, то, как различные триадные цвета чернил смешиваются друг с другом, образуя другие цвета, и время, необходимое для высыхания отпечатка. Профиль — это, среди прочего, комбинация всех этих переменных.

Цвета не совпадают от одной панели к другой при печати мозаичных изображений

Клиент хочет заменить 7-цветный чистящий картридж CMYKLcLmLk+ на 8-цветный CMYKLcLmLk + WH

Возможно, он не определяет исходное положение резака.

Опубликовано в категории: Разное

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *